Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CỦA LHU. CUC Leu. FL F GUU Val GUC Val GUA Val GUG Val Nonpolar AUU lle AUC lle AUA lle AUG Met M -L -V UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position -P A A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gin CAG Gin chicchichch AAU Asn AAC Asn, AAA Lys AAG Lys GAU Asp GAC Asp Basic GAA Glu GAG Glu Y H -Q N -K D E G UGC Cys UGA Step UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg. AGU Ser AGC Ser AGA Arg AGG Arg J GGU Gly GGC Gly GGA Gly GGG Gly Acidic C W -R -R -G Third position (3'end) DURO с DURO A G U с U с A G Stop codon
Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CỦA LHU. CUC Leu. FL F GUU Val GUC Val GUA Val GUG Val Nonpolar AUU lle AUC lle AUA lle AUG Met M -L -V UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position -P A A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gin CAG Gin chicchichch AAU Asn AAC Asn, AAA Lys AAG Lys GAU Asp GAC Asp Basic GAA Glu GAG Glu Y H -Q N -K D E G UGC Cys UGA Step UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg. AGU Ser AGC Ser AGA Arg AGG Arg J GGU Gly GGC Gly GGA Gly GGG Gly Acidic C W -R -R -G Third position (3'end) DURO с DURO A G U с U с A G Stop codon
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...
Related questions
Question
Give typed explanation
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning