Hereditary deafness is an autosomal recessive disorder that occurs in 30% of Dalmatian dogs. 4. What is the frequency of the allele that causes hereditary deafness in the Dalmatian dogs? Record your answer rounded to two decimal places. Answer: (Record your three-digit answer in the numerical-response section below.) Your answer: 0000
Q: Give possible thesis title on seaweeds and enumerate 3 objectives
A: A thesis is a long-form academic paper that presents an original research study or argument on a…
Q: Describe briefly the five levels of DNA packaging in the nucleus. Explain two purposes of these many…
A: Introduction DNA packing refers to the process by which the long, linear DNA molecules are packaged…
Q: the discussion section the authors wrote “The prevailing hypothesis about the action of tACS is the…
A: Hypothesis can be classified into two- alternate hypothesis and null hypothesis. Alternate…
Q: How is the vaccine rate related to herd immunity?
A: Introduction Immunity refers to the ability of the body to defend itself against foreign…
Q: Critical Thinking: The percentage of cases of infertility has gone up recently. Although…
A: Introduction The failure to become pregnant after a year of frequent, unprotected sexual activity…
Q: A survey of Canadian males was performed in during the 1980s. 52% of adult males smoked. The…
A: Lung cancer is a type of cancer that starts in the lungs' cells. It is one of the most common…
Q: 17. In the video, Dr. Lara discusses the results of a meta-analysis published in 2013 by Harri…
A: Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that plays a crucial role in…
Q: Vegetarianism: Health or Hype?
A: Vegetarianism: Vegetarianism is a dietary practice where people choose to abstain from consuming…
Q: This diagram is of a mitochondrion. Which label shows the site of the citric acid cycle? E Chris a)…
A: Cell is an elemental unit and part of structural organization of body which comprises of various…
Q: How many cups of fresh strawberries would an adult male need to consume in one day to meet the RDA…
A: Introduction :- Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that plays a…
Q: daily calories come from carbohydrates? If, my total consumed calories is 1445 kcal and my total…
A: Here, units should be same in order to carry out percentage calculation. Carbohydrate have 4…
Q: Please help with my homework assignment Need to discuss Adderall and any and all relevant nervous…
A: Adderall is a medication primarily used to treat attention deficit hyperactivity disorder (ADHD) and…
Q: Formula C1V1=C2V2
A: The question involves preparing a diluted BSA standard for use in a standard test tube protocol.…
Q: What are the three major components of the inflammasome? O NALP3, procaspase 1 and IL-B O HSP90,…
A: The innate immune response provides immediate, nonspecific defense against a broad range of…
Q: yelè as either anaplerotic or non-anaplerotic (cataplerotic). Anaplerotic reactions synthesis of…
A: Anaplerotic reactions are the reactions that are responsible for the production of intermediates of…
Q: Write a sentence or two defining the essential function or structure where appropriate of the…
A: Cellular parts are essential for the proper functioning of cells and, in turn, for the proper…
Q: Which process increases the rate of messages between neurons in the brain? lateralization…
A: Information is transported via neurons in the human body. Information is sent by neurons between…
Q: When your white blood cells encounter pathogens, they use harsh chemical reactions to destroy…
A: Vitamin C is also known as Ascorbic acid ( a water soluble vitamin), which plays vital role in…
Q: For the following problem please refer to the following significance table: Degrees of freedom (n) 1…
A: The dihybrid cross is one in which the two parents differ in two traits. In a dihybrid cross, the F1…
Q: When is anaerobic respiration most likely to occur? a) saprophytic bacteria in the soil help in…
A: Understanding cell processes is critical because cells are the basic unit of life and perform the…
Q: the blood brain barrier is described as a/an O barrier to all druges reaching the brain O selective…
A: Introduction The brain is a complex organ that serves as the control center of the nervous system…
Q: fill in the blank for the following: a. HPAT2,3, and 5 when prevented from being transcribed…
A: Nucleic acids are biological molecules "Proteins required for the construction and function of all…
Q: 3 3 T TT 10: 8. Write a possible hypothesis for experiment. MICRO MINI 3/4 CREW CREW MID CALF OVER…
A: Introduction A hypothesis is a proposed explanation or prediction for a phenomenon or observation…
Q: Two babies in a maternity ward have lost their identity bands, and there is some confusion about…
A: We are case of two babies with their blood group and mothers blood group. We need to know if the…
Q: 2. If a woman who has no dimples (recessive) and is homozygous free earlobes (dominant) has children…
A: Given that, having dimples is dominant over no dimples while earlobes is having incomplete…
Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC
A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…
Q: A mutant allele in persons with familial hypercholesterolemia (FH) causes death due to a lack of…
A: Introduction : Fatty acid derivative acetyl-CoA is used to make cholesterol. Cholesterol can also…
Q: What does pyruvate oxidation entail? a) the formation of NADH b) coenzyme A c) the release of carbon…
A: Pyruate is the end product of glycolysis. It is a three carbon molecule. It undergoes oxidation and…
Q: Which of the following is the final electron acceptor in the electron transport chain in the…
A: Electron transport chain is the step of cellular respiration which happens in eukaryotic…
Q: how do steroids/sterols chemical structure help with identifying lipids?
A: Introduction :- Steroids and sterols are a type of lipid that have a unique chemical structure that…
Q: Some bacteria can live equally well with or without oxygen. Which of the following terms correctly…
A: Cellular respiration is an important process that is responsible for this breakdown of glucose in…
Q: Carbohydrates, proteins, and lipids can all be used in aerobic cellular respiration, but enter the…
A: Respiration is the process where the food ingredients are broken down to form energy for further…
Q: Design, conduct and summarize results of the analyses outlined below using data collected in the…
A: The question is asking you to analyze the Framingham Heart Study data set using FHS-Exam1, which…
Q: Part 1: The diagram below shows the main components of the male reproductive system. A B с a) Name…
A: Introduction : The biological method used to produce offspring of the same type is called…
Q: It has been said that humans are a keystone species. Do you agree or disagree with this statement.…
A: Introduction: A species is a group of organisms that share common physical and genetic traits, can…
Q: What is the population that is most affected from Unintentional injuries from a vehicular accident…
A: Introduction: motor vehicle accidents are a major public health issue that affects millions of…
Q: what are contributing factors with adolscents in unintentional injuries from vehicular accidents?
A: Introduction: Injuries refer to any physical damage or harm to the body that is caused by external…
Q: In the electron transport chain, the source of energy needed to synthesize ATP gradient across the…
A: There are a few important points: Mitochondria are energy-converting organelles present in…
Q: Compare and contrast antiseptic and disinfectant. What is the hazard of the splattering tendency in…
A: Introduction Sterilization is the process of completely destroying or eliminating all forms of…
Q: What are the advantages and disadvantages of oral contraceptives? How effective are oral…
A: Introduction Sexually transmitted diseases (STDs), also known as sexually transmitted infections…
Q: Identify the following puicture and describe why it is improtant in reproduction.
A: Genetic recombination is the process by which genetic material is exchanged between two different…
Q: Provide three different examples of how female choice has influenced the evolution of a species. At…
A: All the animals face two major challenges, one being survival, having a protective instinct and the…
Q: Introduction for chick embryo
A: Introduction: The growing embryo of a chicken is known as a chick. It is a common model organism in…
Q: How does fermentation differ from respiration in the generation of ATP and the final electron…
A: In glucose fermentation process, there is a net gain of 2 ATP molecules in the glycolysis process.…
Q: Explain why it has been very difficult to obtain an X-ray crystal structure for the complete nuclear…
A: A substantial and intricate protein structure called the nuclear pore complex (NPC) covers the…
Q: Outline possible advantages and disadvantages for organisms in using: (a) anaerobic respiration (b)…
A: Cellular respiration is a metabolic pathway to harness energy from the carbohydrates obtained from…
Q: What are your thoughts about strict vegetarianism (veganism) after reading this chapter (remember,…
A: Introduction Vegetarianism is a dietary practice that involves abstaining from consuming meat,…
Q: Discussion 3.1 Comparing the Utilitarian Approach with Other Approaches After carefully reading the…
A: Introduction Euthanasia is the deliberate taking of a life to end pain and suffering. The…
Q: This UCP1 protein allows the protons (H+) of the mitochondrial intermembrane space to enter the…
A: UCP1 is a unique protein that plays a critical role in thermogenesis and energy balance, and it may…
Q: Body What Happens To Your Body During Exercise…
A: Muscles are very important and integral part of one of the tissues. They control movement by their…
Step by step
Solved in 2 steps
- 10. Record the class data for these traits. Color vision Red-green color blind Widow's peak No widow's peak Trait Widow's peak Free earlobes Mid-digit hair Widow's peak # of WW people # of Ww people q² # of ww people Class data 11. As before, use the Hardy-Weinberg equations to estimate how many people in our classroom population have a given genotype. We will skip this for red-green color blindness because X-linked traits require more complicated calculations. 15 6 9 9 Р Free earlobes Attached earlobes Mid-digit hair No mid-digit hair # of EE people # of Ee people # of ee people p² Free earlobes Class data 6 2pq 9 lo 5 Does p²+2pq+q² = 1? Mid-digit hair E # of HH people # of Hh people # of hh people 12. In our class, is the dominant trait always the most frequent? Why do you think this is? 13. Do you think the frequency of these traits will change if we repeat this experiment in 30 years? (Some food for thought: Do these traits provide an advantage to survival? Do people choose their…Offspring #1 Offspring #2 B'B' - blue eyes BB' - gray eyes G'G' - curly hair GG' - wavy hair E'E - brown hair EE' - brown hair Tt - widow's peak Tt - widow's peak Dd - 7 fingers Dd - 7 fingers LW - dark and light patches LW - dark and light patches HH - horns Hh - horns aa - attached earlobes AA - hanging earlobes FF - almond-shaped eyes Ff - almond shaped eyes RR - blue feet RC - blue and yellow feet M'M' - yellow hands MM' - orange hands QQ - bald spot Qq - bald spot What is your offspring's genotype for eye shape and feet colour? What are the possible gametes resulting from your offspring? What is the mate's genotype for eye shape and feet colour?Student Name: Alyssa york The Hardy-Weinberg Equation 4. Cystic fibrosis is a homozygous recessive condition that affects 1 in 10,000 of the Hispanic population in the United States. Calculate the frequency of the dominant allele, the frequency of the recessive allele, and the percentage of heterozygous individuals (carriers) in the Hispanic population. P qFrequency of the recessive allele 2 p² q² Frequency of the dominant allele 2pq % homozygous dominant % homozygous recessive % heterozygous 0.98 0.02 96.04.7. 0.0.4%
- Trivla Game Show _Make Your Own Tri ngston.schoology.com/common-assessment-delivery/start/4789189591?action=onresume&submissionld=463322566 Dillon WF g Aa v Done In guinea pigs, black hair (B) is dominant to white hair (b) and rough hair (R) is dominant to smooth hair (r). What are all the possible genotypes of a guinea pig that has black, rough hair? (Select all that apply.) O BBRR BBRr BBrr BBRR BbRr O bbRR O bbRr O bbrr O Black O White O Rough OSmooth O Rough O SmoothLet us practice it again! Analyze the pedigree below to answer the questions that follow. Huntington's disease a disorder in which nerve cells waste away, or disintegrate, is passed down through families. certain parts of the brain Huntington's diseate llustration ereated in htps://pregenygenetion.com/ 1. What members of the family above are affected with the Huntington's disease? 2. Tnere are no carriers ior Huntungton's disease you either have it or you do not. Is Huntington's disease caused-by a dominant or recessive trait? 3. Identify the genotypes of the following individuals using the pedigree above. (homozygous dominant, homozygous recessive, heterozygous). I- 1 II -1: II -3: III - 4 : 4. How many children did individuals I-1 and I-2 have? 5. How many girls did II-1 and II-2 have? How many have Huntington's Disease? 6. How are individuals III-2 and II-4 related? I-2 and III-5?A Moving to another question will save this response. Quèstion 14 A normal couple has a daughter with albinism, a recessive trait. What is the chance that their next child will be an albino girl? O 1/4 O 7/16 O 1/8 O 1/2 A Moving to another question will save this response. MacBook Air esc * 12 SO 2$ 4. %23 2 3 5 6 7 W R A H
- Agree or disagree with each of the five statements below and describe why the statement is or is not true. Number your answers so I know which statement you're talking about. Berdon syndrome is a recessive disorder in humans that is typically fatal shortly after birth. This disease will eventually be eliminated from the population because people with the disease die before they reproduce. Jalili syndrome is an extremely rare recessive disorder. A person with one normal allele and one disease allele will not suffer from this disorder. The ability to taste the chemical phenylthiocarbamide (PTC) is a dominant trait in humans. Therefore, the majority of the population must have this trait. An individual's phenotype is determined entirely by their DNA. All mutations are harmful.Paragraph Styles Having dimples (D) is dominant over not having dimples (d). A dimpled woman (whose father had no dimples and whose mother did have dimples) marries a man whose mother had no dimples, whose father had no dimples, and whose grandparents on his father's side did have dimples! 10. Amy Bruwn Science What is the genotype of the woman? What is the genotype of the man? Genotypes Phenotypes How many different genotypes are possible among the offspring? How many different phenotypes are possible among the offspring? What is the probability of getting DD offspring? What is the probability of getting dd offspring? What is the probability of getting dimpled offspring? What is the probability of getting offspring with no dimples? What is the probability of getting homozygous offspring? 12Answer the following questions. 15. Which of the following rows provides the probable percentage of this population with each genotype indicated? The ability to taste the chemical phenylthiocarbamide (PTC) is controlled by the dominant allele T. Individuals who have the allele T find that PTC tastes bitter. Homozygous recessive individuals find that PTC has no taste. In a sample of 320 people, 218 could taste PTC and 102 could not taste PTC. Genotype TT Genotype Tt Genotype tt 23% 45% 32% 19% 49% 32% 44% 37% 19% 15% 29% 56% Many Elk and Whitetail deer live in and around an area 80 km2 area that includes the Jasper town site. Both species depend on similar food sources. The population of the elk tends to show the pattern of distribution illustrated below. 6.6 5.9 9. The elk population of this area at the beginning of a study year was 500. If there were 35 births and 5 deaths throughout the year, what was density of the elk population at the end of the year. 0.060 Row 0.38 n
- I want to solve the third branch ( ratio of phenotype )Part B 1. For the remaining characteristics, you will be looking at homozygous and heterozygous traits. Each trait will be determined to be homozygous recessive, homozygous dominant, or hetero- zygous. Letters representing the alleles will be given to you; the uppercase letter is always dominant and the lowercase letter is always recessive. If both dice rolled are even numbers, it indicates homozygous dominant alleles; if both are odd, it indicates homozygous recessive alleles; if one is odd and the other even, it indicates heterozygous alleles. 2. Eyebrows: Use the alleles "A" and "a" for this trait. Two separate brows are the dominant trait, whereas the unibrow (or one continuous brow) is recessive. 3. Eye shape: Use the alleles "R" and "r" for this trait. Round eyes are the dominant trait; almond shaped eyes are recessive. 4. Hitchhiker's thumb: Use the alleles "H" and "h" for this trait. Straight thumbs are dominant; Hitchhiker's thumbs (the curving upward of the thumb) are…evXcmVNOJBWE30dA6Lb44RSU_edHI7Nomb_8DG1Jq2Vusk/pub?start%-false&loo. O YouTube Маps Cards created from.. GrammarNotes O m4... Trait #2 Chin Shape (1): V=Very prominent; v-less prominent P= Mother &Father F1 Genotype Phenotype Offspring Genotype: Phenotype: 1 3 99+ Fearch 4-