Q: INSTRUCTION: Answer the question properly Do not copy in Google, plagiarize checker will be used.…
A: Gram-positive bacteria are bacteria classified by the color they change in the staining method. Hans…
Q: What are the four levels of protein structure/ organization and what types of bonds are involved in…
A: Proteins are one of the major four biomolecules that are needed by the body for growth and…
Q: Question 6 A group of environmental scientists wants to make a plan that will reduce human impacts…
A: In the lower atmosphere, CO2, methane, N2O, and CFCs are the major greenhouse gases those levels are…
Q: Synapomorphic characteristic of monophyletic group of bony fish and chondrichthyes
A: Synapomorphy It refers to a trait that an original species has and that its evolutionary successors…
Q: The Figueroa family has a genetically inherited trait called ocular albinism-lack of pigment in the…
A: Genetic disease The disease or disorder which is transferred from parents to their offsprings is…
Q: One stand of DNA reads: GACTTCAGATC Whay would the complementary strand be?
A: One stand of DNA reads: GACTTCAGATC What would the complementary strand be?
Q: Because plants do not have skeletons, what accounts for their rigidity?
A: Plants These are eukaryotic organisms that have the ability to produce their own food through the…
Q: Active transport moves molecules OA. toward the region of lower concentration of the molecule. OB.…
A: Active transport is defined as a type of cellular transport in which molecules tend to move from an…
Q: Indicate if each chromosomal abnormality will likely have a phenotypic consequence An individual…
A: Chromosomes are the structures that are condensed DNA threads, they carry genetic information of…
Q: 1. What is the Difference between DNA Purification and RNA Purification?
A: Note: As per guidelines, we can answer one question at a time!! Ask again to get answers.…
Q: NOTE: Human hands are always displayed "palms up, thumbs out"! A single human hand generally…
A: The internal structure of the human body is represented by the skeleton. At birth, it has about 270…
Q: When an electric force is applied to a lipid, the electron clouds stretch and d but the electrons do…
A: Electric fields can induce lateral reorganization of lipids in fluid bilayer membranes. Biological…
Q: learn.edgenuity.com/player/ SC5181 A Mark this and return < : A lichen is an organism that is…
A: Introduction :- Obligate mutualism is a species-to-species connection in which each are totally…
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: We know that Female body undergoes various hormonal changes during pregnancy. Hormonal fluctuations…
Q: 1. Jiro is performing an experiment on photosynthesis using Hydrilla plants. He wants to know which…
A: The Hydrilla is water or aquatic plant. These plants lack stomata and due to these unique…
Q: describe the yeast specimens grown on PDA using Dalmau Plate Method incubated at 35°C for 48 hours…
A: Hansenula anomala This organisms belongs to the kingdom fungi of genus Hansenula anomala is merged…
Q: Which of the following describes a key difference between the 20 amino acids that make up all…
A: The correct option is: Some amino acids contain polar R group, while others contain nonpolar R…
Q: Your graphs should have helped you learn about relationship between size and respiration; what is…
A: Respiration The process of respiration takes place in the mitochondria of the cell.
Q: Is cloning a form of genetic engineering? Explain your answer
A: Genetic engineering, often known as genetic alteration, is a technique that modifies an organism's…
Q: What makes the Leifson stain different from the other stains used in this exercise? How does it…
A: Leifson staining is a bacterial stain used to stain the flagella that are present in bacteria such…
Q: What's the purpose of subjecting the cell homogenate to a series of centrifugation at a sequentially…
A: Cell is an elemental unit of body and is a part of structural organization which contain various…
Q: Describe the flow of blood through the heart, naming each of the vessels bringing and taking blood…
A: Introduction The movement of gases, nutrients, and waste products throughout an organism's body is…
Q: According to the diagram at right, FSH injections to super-stimulate the ovaries will:
A: The anterior pituitary gland creates the gonadotropin known as FSH, or follicle-stimulating hormone.…
Q: Why is it best to use sterile distilled water in the preparation of microbial suspension and dry…
A: Smear preparation is the first step carried out during the staining procedure.
Q: Which statement correctly explains the formation of hydrogen bonds? A B с D The partially negative…
A: The correct option is: The partially positive oxygen atom on one water molecule is attracted to…
Q: Why is it that gram per gream, a mouse's respiratory rate is higher than that of an elephant's? a.…
A: An organism must provide chemicals such as glucose and oxygen to all of its cells (for respiration).…
Q: For each wet mount, describe the appearance of the red blood cells, determine the solution's…
A: The Tonicity of the solution is defined as the capability of the solution to alter its volume by…
Q: Use the forkline method to derive the gametic ratio of cross AabbDD x AABbDd. The cross are…
A: The fork line method can be used to determine the probability of gametes or genotypes. This is done…
Q: In your study of neuron physiology, you learned that depolarization is dependent on the sodium entry…
A: Heart can initiate contractions on its own by SA node (Sinoatrial node). It doesn't need external…
Q: You have two solutions that are isosmotic to each other and to a cell. However, when testing for…
A: Tonicity can be explain as the measure of relative concentration of solute particles present both…
Q: Synapomorphic characteristic of monophyletic group of chondrichthyes and bony fishes
A: A synapomorphic character is shared by some taxa but not others because the former inherited it from…
Q: what are the consequences of pericarditis?
A: The pericardium is the layer(s) surrounding the heart that is made up of connective tissues and it…
Q: A normal mother has translocations on chromosomes 14:21. With respect to chromosomes 14:21, how many…
A: Due to changes in DNA sequence, a mutation happens, and it could be as a consequence of genetic…
Q: In a gel electropherosis, Glutamate and valine created a double bond. How is that possible?
A: Proteins compose the body's fundamental structural constituents and are found in every cell and…
Q: Which of the following describes a potential method for measuring the dependent variable in this…
A: Ad26.COV2 vaccine which have a high efficiency against COVID-19 in the pivotal trial. it's…
Q: What are some of the policy instruments for managing fisheries?
A: Extinction is the dying out or exterminator of a species. Extinction happens due to many reason like…
Q: If your cell can use passive transport without having to use energy, why would a cell invest ATP to…
A: Passive transport is the fundamental movement of ions and other molecular substances within the…
Q: Question 9 the picture shows a student using a microscope to study a prepared slide of single-celled…
A: The correct option is: A. Nucleus
Q: You are a scientist modifying cells to have optimum efficiency of exchange across the plasma…
A: The organism is the individual entity that embodies the properties of life. It is classified into…
Q: used
A: C) Measure how much oxygen is used
Q: Which of the processes does not lead to variation in offspring with the same parents?* A.…
A: variation means any difference between cells or individual organisms of any species caused either by…
Q: 13. Unraveling the structure renders the enzymes useless, this unraveling leads to loss of its…
A: According to our guideline we can answer only first three subparts of a question. So, please upload…
Q: OPU can be done in cows every 3-4 days to obtain oocytes/eggs in the absence of ovarian…
A: Ovum pick up (OPU) is the interaction by which oocytes (egg cells) are suctioned from the follicles…
Q: I need help with the diagrams for aHypertonic, Isotonic, Hypotonic, Solute
A: Tonicity is a property that can make the volume of the cells altered with the water content. The…
Q: An electron carrier is a compound that is reduced and then oxidized. is oxidized and then reduced.…
A: Solar energy is converted into chemical energy in the form of glucose, a simple sugar, during…
Q: What structures are found in a chromosome? Group of answer choices Two structures for the mitotic…
A: structures found in a chromosome : Two structures for the mitotic spindle to bind, and one complex…
Q: Which of the following describes the most likely outcome of a mutation that causes a sin- gle amino…
A: Mutation signifies the change in the nucleotide of the DNA/gene sequence. This change in the gene…
Q: the atmosphere ozone decomposes photochemically reaction O3 + hv→ O(³P) + O₂ 315 < < 1200 nm O3 +…
A: In earth atmosphere the minor component is ozone(O3). It absorbs uv radiation and prevent it from…
Q: 4. If gentamycin and digoxin have first-order distribution rate constants of 0.14 min-¹ and 0.52 h¹¹…
A: The given drugs follows the first order kinetics ; therefore we calculate the time required for the…
Q: Would the respiration rate be different for a person who had just exercised instead of sitting in…
A: Respiration : it is one of the essential physiological process in human body. It Is defined as the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Write two paragraphs answering the following question briefly.
How can transposons contribute to specific human diseases?.
Please give it quickly
Step by step
Solved in 2 steps
- In the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acidTransposons in bacterial genomes can carry genes,including those conferring ________ resistanceMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
- Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the mutant polymerase. A codon chart is found on the final page of the exam. i) This schematic represents a _________ ii) On the schematic, give the nucleotides of the anticodon. Justify your answer27. Once created, new combinations of genes will be acted upon by ________________________________.Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…Answer each of the following correctly. Designer Genes Work (This is all about Applications of Recombinant DNA). 1. How does DNA Replicate?(1-3 sentences only) 2. What is Genetically Modified Organism (GMO)?(1-4 sentences only) 3. Illustrate your own Designer genes using this information:The Arctic apple is a fruit engineered to resist browning after being cut. Currently they are only available in the US – in golden, fuji and gala varieties – where they have been given Food and Drug Administration approval. If approved in Europe, they would have to be labelled as genetically modified. The manufacturers claim the main benefit is to help cut down on food waste. And based on the following: 1. Identify a special trait. 2. Identify a source organism. 3. Identify a target organism 4. Identify the modified/added trait. Example: Hot Tomato > Chili > Tomato > Spicy Tomato It was reported this week that Brazilian scientists are hoping to create spicy tomatoes using Crispr…
- In this section, please change the underlined portion to make the statement TRUE. Please note: this is different from how True/False questions have been done previously, where you had to indicate whether the statement was true or false. For this exam, please assume that all statements are false, and correct the underlined portion to make the statement true. Question 48 During MRNA splicing, U2 binds to the 3' splice site. Blank # 1 Blank # 2 Question 49 The loss of electrons from an atom is called reduction. Blank # 1 Blank # 2Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.