TGTCTAGTTGGCAATTGTCCTAGCCATACTGT How many other codons apart from the one used could encode the last amino acid in thispeptide (i.e. not the stop codon)?Enter your answer hereAmino-acid biochemical properties Nonpolar PolarBasic AcidicTermination: stop codonStandard genetic code1st2nd base3rdbaseAbaseUUUCUUAUUGU(Phe/F) Phenylalanine(Тyг/) Тyгosine(Cys/C) CysteineUUCUCUACUGC(Ser/S) SerineUUAUCAUAA Stop (Ochre)B]UGA Stop (Opa) B)AUUGIAIUAG Stop (Amber)l B]UCGUGG (Trp/W) TryptophanGCUCCUCAUCGUU(Leu/L) Leucine(His/H) HistidineCUCccCACCC(Pro/P) ProlineCCA(Arg/R) ArginineCUAСАCGAA(Gin/Q) GlutamineCUGIAICGCAGCGGAUUACUAAUAGU(Asn/N) Asparagine(Ser/S) SerineAUCAAUA(lle/l) IsoleucineACCAACAGC(Thr/T) ThreonineACAAAAAGAA(Lys/K) Lysine(Arg/R) ArginineAUGIA (MetM) MethionineAGGACGAAGGGUUGCUGAUGGUU(Asp/D) Aspartic acidGUCGCCGACGGC(ValN) Valine(Ala/A) Alanine(Gly/G) GlycineGUAGCAGAAGGAA(Glu/E) Glutamic acidGUGGCGGAGGGGG

The genetic information of all living organisms (except some viruses) is stored in the cell in the…

How many other codons apart from the one used could encode the last amino acid in this peptide (i.e. not the stop codon)? Enter your answer here Amino-acid biochemical properties Nonpolar Polar Basic Acidic Termination: stop codon Standard genetic code 1st 2nd base Зrd base base UUU UCU UAU UGU (Phe/F) Phenylalanine (Tyr/Y) Tyrosine (Cys/C) Cysteine UGC UUC UC UAC (Ser/S) Serine UAA Stop (Ochre)®] UAG Stop (Amber)B) UCA UGA Stop (Opa)B) UUA A UUGIA UCG UGG (Trp/W) Tryptophan G CUU CU CAU CGU (Leu/L) Leucine (His/H) Histidine CGC (Arg/R) Arginine CUC c CAC (Pro/P) Proline CUA CA CAA CGA A (Gin/Q) Glutamine CUGIA cCG CAG CG G ACU AGU AUU AAU (Asn/N) Asparagine (Ser/S) Serine AUC (le) Isoleucine ACC AAC AGC (Thr/T) Threonine AUA ACA AAA AGA A (Lys/K) Lysine (Arg/R) Arginine AUGIA (Met/M) Methionine ACG AAG AGG G GUU GCU GAU GGU (Asp/D) Aspartic acid GUC GCC GAC GGC (Val/V) Valine (Ala/A) Alanine (Gly/G) Glycine GUA GCA GAA GGA A (Glu/E) Glutamic acid GUG GCG GAG GGG G

How many other codons apart from the one used could encode the last amino acid in this peptide (i.e. not the stop codon)? Enter your answer here Amino-acid biochemical properties Nonpolar Polar Basic Acidic Termination: stop codon Standard genetic code 1st 2nd base Зrd base base UUU UCU UAU UGU (Phe/F) Phenylalanine (Tyr/Y) Tyrosine (Cys/C) Cysteine UGC UUC UC UAC (Ser/S) Serine UAA Stop (Ochre)®] UAG Stop (Amber)B) UCA UGA Stop (Opa)B) UUA A UUGIA UCG UGG (Trp/W) Tryptophan G CUU CU CAU CGU (Leu/L) Leucine (His/H) Histidine CGC (Arg/R) Arginine CUC c CAC (Pro/P) Proline CUA CA CAA CGA A (Gin/Q) Glutamine CUGIA cCG CAG CG G ACU AGU AUU AAU (Asn/N) Asparagine (Ser/S) Serine AUC (le) Isoleucine ACC AAC AGC (Thr/T) Threonine AUA ACA AAA AGA A (Lys/K) Lysine (Arg/R) Arginine AUGIA (Met/M) Methionine ACG AAG AGG G GUU GCU GAU GGU (Asp/D) Aspartic acid GUC GCC GAC GGC (Val/V) Valine (Ala/A) Alanine (Gly/G) Glycine GUA GCA GAA GGA A (Glu/E) Glutamic acid GUG GCG GAG GGG G

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 7SQ

See similar textbooks

Similar questions

Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
Question Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third Base
Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met
Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)
The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 2 1 Glu Ile 4 Stop Ile Mutation 1: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the protein sequence. Mutation 2: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the…
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
READ INSTRUCTIONS WND COMPLETE MRNA CODON COLUMN
mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…