If evolution is true then why do new species seem to appear out of nowhere in the fossil record? Here we see intermediate forms that show a progression over time VS. Wait where did those projections come from? And what's up with that pattern?
Q: What part of the eye does cataracts affect? Bottom J Top J OC OG None of the choices are correct P 0…
A: The eye is a complex sensory organ responsible for the sense of sight. It is made up of several…
Q: Give typing answer with explanation and conclusion The activity of ____ motor proteins interacting…
A: Motor proteins are biomolecules that utilize the energy from ATP hydrolysis to move microfilaments…
Q: An individual has the following reciprocal translocation: B CDE H B CDE H A J e. What is the name of…
A: When two non-homologous chromosomes exchange their chromosome segments, the resulting chromosomal…
Q: The effectiveness of the agar well diffusion method.
A: The agar well diffusion method is a cost-effective and straightforward test to evaluate the…
Q: Which of the following is true regarding water? O It makes up approximately 10% of the human body It…
A: Water plays a key role in variety of functions in the living organisms. Some of the key roles of…
Q: Which one of the following concerning the genetically modified purple tomato is correct? It was…
A: GMO stands for genetically modified organism. It refers to any organism, such as plants, animals, or…
Q: QUESTION 4 Antibiotics that affect protein synthesis could cause liver and bone marrow problems in…
A: Antibiotics are a class of drugs that are used to treat bacterial infections in humans and animals.…
Q: Simply explain how saponins function as detergents?
A: Saponins are a type of natural compound that is present in various plants that has a number of…
Q: Is the concept of infectious dose applicable to Covid -19 infections? Why/Why not?
A: The "infectious dosage" is the quantity of a pathogen needed to cause an infection. It is improbable…
Q: In the two competition study experiments below, what can you say about the relative affinities of…
A: From both the given figures, it can be stated that the relative binding affinity of the labeled…
Q: WHICH OF THE FOLLOWING STATEMENTS IS CONSISTENT WITH THE RESULTS OF THE EXPERIMENT?…
A: ATP or Adenosine Triphosphate is the principal energy source of the cell. The ATP molecule contains…
Q: Can you help me to explain every questions part d, part e, part f, and part g with these answers?
A: As asked by the student, we will be providing explanation to the last four parts of the question…
Q: Some ecologists have dismissed the terms "R" and "K" and have replaced them with the terms…
A: Species can broadly be classified into two categories based on their rgrowth rate and rate of…
Q: DNA obtained from the indicated donor strains is used to TRANSFORM the indicated recipient strains.…
A: The correct answer is option C. Arginine The arginine locus is closest to serine.
Q: You are studying lung cancer and use a microarray to compare gene expression between a lung cancer…
A: Note:- Since you have posted multiple questions, so we will be solving the first one for you as per…
Q: Do you think the COVID-19 pandemic will significantly impact on water systems? With respect to…
A: COVID-19 stands for coronavirus disease 2019. It is an infectious disease caused by the SARS-CoV-2…
Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…
A: A codon is a sequence of three nucleotides (a triplet) that encodes a specific amino acid or signals…
Q: Table 4. Transduction Plates Result Plate Number of colonies E. coli-only nagC phage only rpoA phage…
A: Table 4 presents the results of a transduction experiment where different plates were inoculated…
Q: If we watched a eukaryotic cell initiate translation, one of the first things we would see is a.…
A: Transcription is the process by which the information in the gene is coded into a mRNA (messenger…
Q: Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response…
A: The SOS response is a DNA damage response mechanism in bacteria that is activated when the cell is…
Q: Imagine two populations of fish who are part of the same species. Though they are the same species,…
A: Genetic Variation refers to the difference in the genetic make up of individuals present in a…
Q: Answer choices for A: deletion, transversion, insertion, transition Answer choices for B: nonsense,…
A: In the given sequence, the translation starts from the mRNA sequence of the underlined part of the…
Q: Describe at least one mechanism that exists to switch off a signal after a signal transduction has…
A: Transduction is the process by which a cell or organism converts one form of energy or signal into…
Q: Between which two markers is the F factor located in strain 4? strain early late 1. 3. 5. O X and A…
A: This question is asking about the location of the F factor in strain 4. We need to identify the two…
Q: Between which two markers is the F factor located in strain 4? strain early →late 1. 3. 5. O X and A…
A: This question is asking about the location of the F factor in strain 4. We need to identify the two…
Q: Use the table to answer the question. In 1928, Frederick Griffith injected four groups of mice…
A: Transformation is a process of genetic transfer in bacteria where a recipient bacterial cell takes…
Q: Give typing answer with explanation and conclusion to all parts Total nucleic acids are extracted…
A: In molecular biology, the analysis of nucleic acids is a fundamental aspect of understanding…
Q: Part D-This requires you to analyze a graph, answer a question and the hypothesis. Part D The bar…
A: Renewable resources of energy are explained as those sources of energy which will never get…
Q: list 4 plant branches and for each one determine: What is the phyllotaxy of the plant? Are the…
A: As there are no specifically mentioned plants, I'm answering this question with 4 random plants.
Q: With the decline in carbon dioxide concentration in the set-up, which between the C3 and C4 plants…
A: Photosynthesis is a process in which green plants prepare their own food in the form of glucose with…
Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…
A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…
Q: Question 2 Glomerular (Bowman's) capsule and the glomerulus make up the O renal pyramid. O nephron…
A: The glomerulus is a tiny ball-shaped network of capillaries located in the renal corpuscle of the…
Q: Give 5 difficiency symptoms of Potassium and Calcium in plants
A: Potassium (K) and Calcium (Ca) are essential macronutrients that are necessary for plant growth and…
Q: What is one thing in our modern environment that we are more poorly adapted to than in our…
A: Our sedentary lifestyle is one aspect of our modern world to which we are less well adapted than we…
Q: In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs…
A: The wobble hypothesis, proposed by Francis Crick, describes how the third nucleotide in a codon (in…
Q: eat of get eaten THINK ABOUT IT- Look at the food web below and answer the questions. FIGUR 6.3 Food…
A: The food web consist of several food chains that are interconnected and forming a network like…
Q: 1which test is used to differentiate between fermentative and oxidative metabolism?describe the…
A: 1.The test used to differentiate between fermentative and oxidative metabolism is the…
Q: 5' new 11. A. Which end of a newly generated DNA strand is unable to replicate a short segment of…
A: Deoxyribonucleic acid also known as DNA, is a molecule that contains the genetic instructions…
Q: The following diagram shows a DNA palindrome. Supply the missing bases and use the circled base as…
A: DNA Palindrome sequence is a segment of DNA in which the nucleotide sequence on one strand reads the…
Q: Which of the following formulas are correct regarding productivity? (recall, GPP gross primary…
A: Gross primary productivity It is the total amount of carbon compounds produced by a plant in an…
Q: Imagine the unlikely case that the 11 individuals represented in the gel image above were truly…
A: Agarose gel electrophoresis is method of gel electrophoresis, in which DNA fragments are separated…
Q: Question 1. Describe an action potential in a muscle fiber in detail, know the changes in voltage…
A: An action potential is a brief electrical signal that travels along the membrane of a neuron or…
Q: Let us assume that an insect population in its first year has 5 individuals, in its second year has…
A: The change in the number of individuals in a population over time is called population growth. This…
Q: Why is it not necessary to include a caloric content statement on the information panel
A: "Calorie" is defined as the "energy" of a food product. It is a unit of measurement that defines how…
Q: The inner nuclear membrane is lined by the nuclear lamina, a filamentous network which serves as an…
A: Nucleus is the brain of cell. It contains chromosomes that consists of gene that allows the…
Q: cells undergo programmed cell death. Write out the pathway(s), noting the changes (e.g.,…
A: Cell division is a fundamental process in living organisms that allows for growth and tissue repair.…
Q: An average-weight woman without insurance coverage had unprotected sex and wants to avoid pregnancy.…
A: There are three main types of emergency contraception methods: copper intrauterine devices (IUDs),…
Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5
A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…
Q: A common misconception about mutations is that they are always harmful. What mutation effects on an…
A: A mutation is a change that occurs in the DNA sequence of a gene or a chromosome. Mutations can be…
I need help answering the big font question from my teacher presentation: If evolution is true then why do new species seem to appear out of now ehere in the fossil record?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Imagine that you have the DNA sequences fromthe intron of a gene in three species called A, B,and C. Species A and B are most closely related,while C is more distantly related. The sequencesof A and B differ by 18 base pairs, A and C differby 26 base pairs, and B and C differ by 28 basepairs. Fossils show that species A and B divergedabout 1.2 Mya, but there is no fossil evidence asto when the most recent common ancestor ofall three species lived. Use the genetic data toestimate that date. What assumptions are youmaking to get this estimate?What must be TRUE of any organ described as vestigial? It need be neither homologous nor analogous to some feature in an ancestor. O It must be analogous to some feature in an ancestor. O It must be homologous to some feature in an ancestor. OIt must be both homologous and analogous to some feature in an ancestor.How did all the different body types in the Cambrian arise so quickly? O Hox genes had evolved that determine and allow for the diversification of body plans. Because Hox genes hadn't evolved yet, there was a lot of flexibility in how body plans could develop. O There was a genome duplication event that led to the diversification of body plans. Enhancer driven gene expression had just evolved, which made it easier to vary body plans. Toing wheroptiones 29
- Snakes evolved from ancestors who had the ability to walk. Some snakes, in fact, still have small pelvis and leg bones that are rermnants from this ancestor. What are these called? * O Vestigial structure Homologous strucre O Sympatric structure Molecular homologyEvolution of Whales This is an example of how microevolutionary changes eventually result in the formation of a by macroevolution. 1. How many species are in the diagram? 2. What living animal are whales most closely related to? 3. What happened to whales' closest cousins? Outgroup Masonychia Perissodactyla Gujaratia pakistanensis Wasatchian Diacodexts Homacodon Tylopoda Sulformes Ruminantia Anthracotheres Cebochoerus Hippopotamids Khirtharia Indohyus Cetacea Distantly Related Mammal Extinct Ancestor Group Rhinos, Horses, Tapirs Pigs Cows/Sheep Hippos Extinct Artiodactyl Extinct Whale "Cousin" Modern WhalesA вс D E F G scales fur/ scales spikes horns horns claws feathers hair a) Which trait(s) did the most recent common ancestor of dragons A and B have? [ [ Select ] b) Which trait(s) appear to be the result of convergent evolution? [ Select ] c) Which trait(s) does dragon D have? [Select ] d) Which taxa is most closely related to dragon B? [ Select ] f) True or false? The clade formed by dragons D, E, and their most recent common ancestor is monophyletic [ Select ] e) Which trait(s) did the most recent common ancestor of dragon species A and E have? [ Select ]
- Why was the Cambrian era most unique among the fossil record of animal evolution? O Soft bodied animals fossilized only in this era. O Speciation of animals occurred only in this era. O All basic animal body types present today were found in this era. O Animal fossils are found only in this era.Segmentation has evolved several times and occurs in most animal supergroups. What advantages do segmented taxa have over their unsegmented relatives?In the late 1800's, a biologist studying animal embryos coined the phrase, "ontogeny recapitulates phylogeny", meaning that the physical development of an animal embryo (ontogeny) seemed to retrace the changing form of the species during its evolutionary history (phylogeny). Why would embryonic development retrace evolutionary steps?
- What are the most fundamental (oldest) characteristic(s) in the evolution of these animals (EMU, Liver fluke, Octopus, polar bear, raw pore rope sponge, and green frog).The fossil record is biased because... Actually, this bias is only perceived; older eras had completely different body plans which makes it look like a lot of fossils are missing, while instead they existed. O Fossilization only happens under dry, arid conditions, which is most common in limited, desert like conditions. O The decomposition of an organism needs to slow down to increase chance of fossilization, which only happens under certain conditions. O Only organisms living in the deep ocean have a chance of fossilizing, because those are ideal conditions. 29 In TOIs the fossil record a complete picture of all of the living things that have ever existed on earth? Why or why not?