If you were to compare the amino acid sequences of histone proteins across several distantly-related species (say, plants, animals, fungi), would you expect the sequences to be highly similar or highly varied? Explain your reasoning.
Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…
A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…
Q: How many copies of each type of core histone would it take to wrap the entire human genome into…
A: Introduction -The haploid human genome is made up of roughly 3 billion base pairs of DNA organised…
Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…
A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…
Q: Suppose you performed two BLAST searches, one on the peptide sequence FIDPWE, and another on the…
A: BLAST is a computer algorithm that is available for use online at the National Center for…
Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…
A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…
Q: The A+T:G+C ratios in DNA of cattle and rat are very similar. Would you expect the +RNAs, rRNAs,…
A: Gene expression refers to the highly regulated complex biological mechanism involving the…
Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…
A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…
Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…
A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…
Q: In a typical eukaryotic cell, would you expect to find more molecules of the H1 histone or more…
A: Histones are basic proteins that are associated with the DNA present in the nucleus and help in…
Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…
A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: Genetics is the study of how traits are passed from one generation to another. This includes but is…
Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…
A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…
Q: Approximately what portion of the human genome is composed of repeat sequences?
A: According to the results found in the human genome studies it is seen that the human genome has…
Q: . The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age…
A: Amyotrophic lateral sclerosis (ALS) is a paralyzing neurodegenerative disease which is usually fatal…
Q: Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that…
A: Amino acid The building blocks of proteins. The protein is a polymer made up of chain of amino…
Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…
A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…
Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…
A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…
Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…
A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…
Q: One of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic…
A: DNA is the hereditary genetic material found in cells of living organisms. In eukaryotic cells, DNA…
Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…
A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…
Q: There are characteristic differences in the nucleotide sequences of the leading and lagging strands.…
A: Deoxyribonucleic acid(DNA) is a molecule that contains two polynucleotide chains that coil around…
Q: The genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over…
A: Genes are the stretch of the DNA that codes for the polypeptide chain during the process of gene…
Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…
A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…
Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…
A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…
Q: The average of a number of closely related but nonidentical sequences is referred to as a(n)…
A: Homologous sequence
Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…
A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…
Q: Would you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in…
A: Single nucleotide polymorphisms in short SNPs refer to the variation in a single base pair that…
Q: An ORF 1,200 bp in length can encode a protein of what size?
A: Proteins Proteins are the building block of our body they are synthesized by the process of…
Q: Why is rRNA so suitable for determining relatedness?
A: Cells form life's basic unit. A cell has different macromolecules, including carbohydrates,…
Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…
A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…
Q: Suppose that a nearly perfect 20- basepair inverted repeat is observed in a DNA sequence. Provide…
A: The copies of the DNA sequences that are organized in opposing orientation are called “inverted…
Q: If proteins were composed of only 12 different kinds of aminoacids, what would be the smallest…
A: A codon is a sequence of 3 DNA/RNA nucleotides that corresponds to a specific amino acid during…
Q: An alanine residue exists at position 180 of a certain plant protein. If the codon specifying…
A: Substitution Replacement of one Nitrogenous base by another Nitrogenous base is called as…
Q: Explain how a multiple sequence alignment can identify functional sites in a genetic sequence.
A: Sequence alignment can be defined as the pattern of arranging the sequences of DNA, RNA, or protein…
Q: In many eukaryotic organisms, a significant proportion of cytosine bases are naturally methylated to…
A: Cytosine methylation is a type of post-replication DNA modification seen in both prokaryotes and…
Q: Explain why polypeptides have such variable sequences.
A: Polypeptides are the polymers of the amino acids which are linked to each other by a peptide bond.…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: What are the key properties of the genetic code? Given that the genomes of all organisms are made up…
A: Genetic code is the sequence of nucleotides in DNA or RNA which determines the sequence of amino…
Q: Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?
A: The proteins or peptides that are inserted into the plasma membrane are called integral membrane…
If you were to compare the amino acid sequences of histone proteins across several distantly-related species (say, plants, animals, fungi), would you expect the sequences to be highly similar or highly varied? Explain your reasoning.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.
- Hemoglobin from the Galapagos tortoise is 64% identical to that from human beings. In contrast, a protein called histone H2B is 98% identical in these two organisms. What level of identity would you expect for histone H2B for gorillas compared with human beings? 0% 32% 64% 100% Would histone H2B be as useful a molecular clock as hemoglobin? No, because its sequence changes too quickly. Yes, because its sequence changes slowly enough. No, because its sequence changes too slowly. Yes, because its sequence changes quickly enough.Suppose you are comparing two sequences that are 100 bases long. To calculate the percent similarity (also referred to as percent identity) between the two sequences, you simply count the total number of bases that are identical between the two sequences and divide that value by 100. For example, if two sequences that are 100 bases long have 80 80 bases in common, the percent similarity would be 80% ( 100 x 100). Now practice with three shorter sequences. The following sequences are from three related organisms: Organism A: TGGCATTCAT Organism B: TCGAATACGA Organism C: TGCCTTACAT Drag the terms on the left to the appropriate blanks on the right to answer the questions. Not all terms will be used. Reset Help 30% What is the percent similarity between organisms A and B? 40% What is the percent similarity between organisms A and C?Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
- How many comparisons are needed to count the number of duplicates in a list? How many comparisons are needed to find the maximum value in a list of numbers? How many unique length 3 codons coding amino acids can be made from the unique 4 nucleotides found in genes?The amino acid sequences of a yeast protein and a human protein having the same function are found to be 60% identical. However, the corresponding DNA sequences are only 45% identical. Account for this differing degree of identity.You are interested in studying a unique protein found in a rare wildflower found in the desert region of Atacama. The wild-type amino acid sequence isolated from this flower is: Wildtype: Arg-Lys-Thr-Leu-Gly-Arg A mutant for the gene that specifies this protein is isolated and the amino acid sequence of its protein is determined: Mutant: Arg-Lys-Thr-Leu-Gly-Gly a) Identity what the mutation changed in the amino acid sequence b) What is the effect of the mutation at the amino acid level? c) What is the effect of the mutation at the RNA level? d) What kind of mutation happened at the DNA level?
- The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. CompareYou have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and diverge more slowly than the genes that encode them.