In Drosophila flies, the allele b gives a black body, and the allele b+ gives brown, the wild-type phenotype. The allele wx of a separate gene gives waxy wings, and wx+ gives non-waxy. The allele cn of a third gene gives cinnabar eyes, and cn+ gives red. A female heterozygous for these three genes is testcrossed, and 745 progenies are produced which are phenotypically classified as follows: (see image) Make a linkage map of the three genes. Compute for interference and explain what the derived value means

In Drosophila flies, the allele b gives a black body, and the allele b+ gives brown, the wild-type phenotype. The allele wx of a separate gene gives waxy wings, and wx+ gives non-waxy. The allele cn of a third gene gives cinnabar eyes, and cn+ gives red. A female heterozygous for these three genes is testcrossed, and 745 progenies are produced which are phenotypically classified as follows: (see image) Make a linkage map of the three genes. Compute for interference and explain what the derived value means

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter21: Musculoskeletal And Anti-inflammatory Drugs

Section: Chapter Questions

Problem 17CRQ

See similar textbooks

Similar questions

15) Examine the diagram of a reflex arc shown below. In this case, pain from tissue damage to the hand results in a response where muscles move the hand away from the painful stimulus. ST. gridld.doi vd ehow or2 1o notelvib dot Figure 38-10 Biology; Life on Earth, 8/e © 2008 Pearson Prentice Hall, Inc. barostin 20 a) On the diagram above, label the motor neuron, the sensory neuron, the interneuron, and the effector. b) List any way or ways in which the nervous system will determine the intensity of the pain the example above. Corobral cortex
An action potential is considered an "all or nothing" event. What does this mean? Explain using the picture below to discuss what happens during each event. Use the letters in the diagram to match the events. +40- В -C 0- -40- E -60- -80- A 1 3 4 Time (msec) MAR 15 w MacBook Air 888 F2 F3 F4 F5 F7 FB F10 %23 24 & 3 4 6 8 %3D E T Y P 11 C V M command option Membrane potential (mV) .. ..
12:42 1 l 5G Today Edit 12:40 AM If a baseball is coming at your face, you blink FAST in a reflex manner. A reflex is composed of all of the following EXCEPT A neuron that travels within the spine up to the cortex of the brain An afferent neuron incoming to the spinal cord OA motor or efferent neuron exiting from the spinal cord O An effector, which carries out the response
Which of the following structures has activity like acetylcholine? HyC H-C HC NMeg NMey D]
12) Label the parts of the neuron that are numbered below and indicate their general function: 3 25 2 ba orpo cma 4. B dgnel bobner AMosby items and derived itsmg 2010, 2006. 2002, 1997, 1se2 by Mosby, Inc., an affiliate of Elsevier inc. Number: Name of neuron structure: Function of neuron structure: 1. Axon terminal 2. 3. 4. 5.
PA Tupnu u ow nh8 The jaom od Figure 38-10 Biology; Life on Earth, 8/e © 2008 Pearson Prentice Hall, Inc. a) On the diagram above, label the motor neuron, the sensory neuron, the interneuron, and the effector. b) List any way or ways in which the nervous system will determine the intensity of the pain in the example above. 12) 12 TO
Label #8 identifies neurilemma axon node of ranvier myelin sheath 15 12 13 LE1 11 WH 10 9 14
What would be the result of a substitution of TA for the CG at position 9?
燕一 1 4, 3 2 Which of the following rows correctly identifies the synapse and the method of transmission a nerve impulse travels? Select one: а. Synapse Method of Transmission 1 Sodium and potassium ions b. Synapse Method of Transmission 2 Sodium and potassium ions С. Synapse Method of Transmission Neurotransmitters d. Synapse Method of Transmission 2 Neurotransmitters
Arrange the events that occur during synaptic transmission. Use letters A-F to denote the correct sequence. Use the diagram on the right as a clue. Example: SENDING NEURON B 1. lon channel opens Synepto SYNAPSE 1. lon channel opens 2. Neurotransmitter is released into synaptic cleft SYNAPTIC CLEFT RECEVING HEURC4 Neurotransmitter 3. Vesicle fuses with plasma membrane Jon chennels Neurotransmtter Reseptor deurotranemitter brohen down and sa sd 4. Neurotransmitter binds to receptor BOns 前命 5. Action potential arrives 6. lon channel closes the obeicos in the bo y belo M (A n
4. Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC TCTGGATTTTCCCCCGGCGGCGGCGCGCGCGCGCGCGTGTGTGTCCCACAC AGGGCCCCCAGGCTGGACCCACCCGGCCTGCTGCTCGAGCTGCGCTCCGGT GGTCGCGGTGCT Which of the following is least likely to assist you in optimizing the reaction? a. Increase the denaturation temperature b. Use a thermostable polymerase that has a lengthy half-life at 95°C c. Supplement the reaction mix with DMSO, formamide, urea, or Betaine d. Lower the primer annealing temperature e. Use a dNTP mix with 7-deaza-dGTP
If your index finger had to be amputated as a result of a freak what would happen to your S1 somatotopic map of your fingers? A) The neurons in S1 that had previously responded to stimulation on the index finger would begin to respond to stimulation of the thumb and middle finger B) The neurons in S1 that had previously responded to stimulation on the index finger would begin to respond to stimulation of the foot and toes C) The neurons in S1 that had previously responded to stimulation on the index finger would die and the neurons from the thumb and middle finger would reproduce and expand their respective maps D) None of the above