In histones, there are high content of two residues: Lys and Arg, because these residues can a. break DNA double helix O a. O b. O c. O d. O e. interact with the negative ion phosphate of DNA prevent protein and DNA denaturation form hydrogen bonds with sugars break the hydrogen bonds between the base-pairs
Q: Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to…
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: Classify the diluents use with respect to their osmotic pressure in relation to their contents of…
A: Cell membranes are semipermeable barriers, and osmotic gradients between intracellular and…
Q: 2. Enzymes of the pyruvate dehydrogenase complex.
A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: 1. Scheme of aerobic oxidation of glucose and energy balance.
A: Aerobic oxidation of glucose is also called cellular respiration. Cellular respiration is a…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Carbon tracing is a biochemical technique of tracking the path taken by a specific carbon atom in a…
Q: A new oxygen transport protein that exhibits cooperative binding has been isolated and is being…
A: The Hill equation for O2 binding to a protein can be used to solve this problem. The equation is…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Two villages depend on agricultural corn as their primary food source. Pellagra, a niacin…
A: Pellagra is a deficiency disorder caused due to lack of niacin in the diet. The disease is more…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: discuss the G-protein coupled receptors structure and overview of G-protein dependent signaling…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: We know that ketone body synthesis occurs due to high activity of ß-oxidation in the liver. Whic of…
A: During starvation, triglycerides are broken down into constituent fatty acids and glycerol. Fatty…
Q: A scientist made mistakes during DNA extraction. On his first attempt, he blended the sample too…
A: Blending is done when DNA is to be extracted from multicellular samples like tissues of animals and…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: Which of the following is CORRECT?
A: In the reaction of Glycolysis, the △G values of the three irreversible reactions are : Glucose +…
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Beta oxidation generates substrates for cellular respiration through which of the following…
A: The body requires an ongoing flow of energy to carry out its functions. Several substrate molecules…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: Serine, cysteine, threonine can participate in hydrogen bonding. Valine cannot. Explain differences…
A: Alpha carbon of amino acids contains amino group, carboxyl group, hydrogen atom and side chain…
Q: Which of the following can serve as a source of carbon for gluconeogenesis? O cholesterol O alanine…
A: Gluconeogenesis is the metabolic pathway that produces glucose from non carbohydrate precursors.…
Q: What is qualitative analysis of lipids? How important qualitative analysis of lipids in the field of…
A: Lipids are one of the 4 major groups of biomacromolecules. Lipids are a set of biomacromolecules…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which of the following statements is true about the quaternary structure of protein? A) The…
A: There are 4 different types of proteins structures: 1. primary: It is the sequence of amino acids…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: What is the name of this cofactor related to niacin? 0 O-P :0 U -ро OH -CH₂ Н Н OH NH₂ OH Н OH 2+…
A: Niacin is also known as vitamin B3. It is also known as nicotinic acid. It is a water soluble…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Q: Identify which of the following pairs of amino acid residues can have hydrogen bonding between…
A: The three dimensional structure of a protein is necessary for attaining its functional form. The…
Q: ½ O₂ + 2H+ +2 e → H₂O FAD + 2H+ + 2e → FADH₂ E'º = 0.816V E'º = -0.219V Calculate the AG" of the…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Biological waxes are all: A) trimesters of glycerol and three long chain saturated fatty acids. B)…
A: Introduction: Lipids are hydrophobic molecules that are composed of carbon, oxygen, and hydrogen.…
Q: Considering that calcium and ATP are required for muscle contraction, what might explain why calcium…
A: Pyruvate dehydrogenase complex (PDHC) is made up of three subunits, called E1, E2 and E3. E1 is also…
Q: Compare and contrast glycerophospholipids and triacylglycerols(functions, structure), including…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 1 the concentration of the enzyme competition inhibitor was 1×10-3M. If 1 µmol of the inhibitor is…
A: The inhibitor is a competitive inhibitor, as can be seen from the table. The activity of enzymes…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: True or False – During fermentation, pyruvic acid is reduced by FADH2 to free up FAD+ to keep…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: Draw the structure of the following: (in the image provided) Use the amino acids below. F -…
A: Recall that: Amino acids have an amino group, a carboxyl group and a side linked to the same carbon…
Q: 5. Consider the fatty acid. Which of the designations are accurate for the fatty acid? -O O A) (0-6…
A: Fatty acids are the monomer units for the lipid biomolecules. Fatty acids are classified into…
Q: H Overall: R acetone Mechanism Synthesis of Dibenzalacetone. Eto: + Etö: -1 11 benzaldehyde :ÖEt…
A: Definition: Two aldehydes that react in the presence of a base to form a beta-hydroxyaldehyde, which…
Q: A scientist is studying the enzyme X which is an important point of regulation in the metabolism of…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
![In histones, there are high content of two
residues: Lys and Arg, because these
residues can
O a. break DNA double helix
O b.
O C.
O d.
O e.
interact with the negative ion phosphate of DNA
prevent protein and DNA denaturation
form hydrogen bonds with sugars
break the hydrogen bonds between the base-pairs](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F45c459d4-c7f0-416a-8b1d-00b29b90700e%2F5c2a3d9c-83fd-4821-ad11-dc10bd115b9b%2Fur1oz5e_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 4 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and cA nucleosome consists of (a) DNA and scaffolding proteins (b) scaffolding proteins and histones (c) DNA and histones (d) DNA, histones, and scaffolding proteins (e) histones only
- All are true for DNA polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / genereer dsDNA vanaf SSDNA B. requires a primer with a free 5'- OH end, but the 3'-end may be phosphorylated / benodig 'n voorvoerder met 'n vrye 5'-OH-groep, maar die 3'-einde kan gefosforileer word. C. copies the sequence of nucleotides of one strand in a complementary fashion. / kopieer die volgorde van nukleotiede van een streng komplementêr. D. synthesizes new strands by adding successive nucleotides in the 5'→3' direction. / sintetiseer nuwe stringe deur opeenvolgende nukleotiede in die 5 '→ 3' rigting toe te voeg. E. copies the sequence of nucleotides of one strand to form a new second strand. / kopieer die volgorde van nukleotiede van eenHistones form more accessible chromatin because of Select one: a. Reduced electrostatic attraction between the histone and the negatively charged DNA backbone b. Increased electrostatic attraction between the histone and the negatively charged DNA backbone c. Reduced covalent bonding between the histone and the negatively charged DNA backbone d. Increased covalent bonding between the histone and the negatively charged DNA backboneConsider the following segment of DNA:5′ GCTTCCCAA 3′3′ CGAAGGGTT 5′Assume that the top strand is the template strand usedby RNA polymerase.a. Draw the RNA transcribed.b. Label its 5′ and 3′ ends.c. Draw the corresponding amino acid chain.d. Label its amino and carboxyl ends.Repeat parts a through d, assuming the bottom strand tobe the template strand.
- Which repeating sequence below would you expect to find on the end of the longest DNA strand of a chromsome (select one)? A. 5'-TTTTTT-3' B. 5'-TTAGGG-3' C. 5'-CCCTAA-3' D. 5'-AAAAAA-3' E. 5'-GGATCC-3'Histones are a family of positively charged proteins binds tightly with negatively charged, DNA, Histones most likely contains amino acids with R groups of what type? O a. AcidicR group O b. Basic R group O c. Hydrophobic R group O d. Hydrocarbon R group O e. Non-polar R groupA mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?
- 7. The beads on a string in the picture represent what in terms of DNA folding? eir functions. "Beads on a string" 0.05 um 2012 Pearscn Education Inc 300-nm looped domains b. Metaphase chromosome c. pearls d. Individual histones e. nuclosoOmes 8. A particular triplet of bases in the template strand of DNA is 5' ACT 3'. The corresponding codon for the MRNA transcribed is a. either UCA Or TCA, depending on wobble in the first base. b. 3'ACU 5'. c. 5' TCA 3'. d. 3' UGA 5'. e. 3' UCA 5'. LenovoA small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine baseIdentify the sites of lagging strand synthesis. Select all that are true. B A 5 O a. C O b. D O c. A O d. B
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)