Is this a graph of an acute, chronic or latent disease? Period ofillnessPeriod ofdeclineMost severeSignsandsigns andsymptomssymptomsTimeNumber of microbesIncubation period (no signs or symptoms)Prodromal period (mild signs or symptoms)Period of convalescence

Diseases are mainly of three types : 1) Acute Disease - This type of a disease has a short term but…

Answered: Is this a graph of an acute, chronic or…

Science

Biology

Is this a graph of an acute, chronic or latent disease?

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter15: Feed And Protect Me

Section: Chapter Questions

Problem 10FITB

See similar textbooks

Related questions

Q: Is there an alternative to vaccination in preventing influenza?

A: Influenza is caused by influenza viruses. Two types of influenza, A and B, cause outbreaks in…

Q: What do you mean by contagious disease? use your own words to explain?

A: A disease can be defined as a disorder or deviation in the physical, physiological or any other…

Q: What are infectious diseases and means of transmission?

A: Introduction: Infectious illnesses are those that are caused by organisms such as bacteria, viruses,…

Q: What is epidemiology?

A: Epidemiology is a study that provides information about a health-related concern in a specific…

Q: Natural disease processes generally involve specific organ systems: Cardiovascular Disease involves…

A: Injury are of various type and they can present in various pattern which can be recognised and…

Q: What is the symptom-free period of a disease called?

A: Producing only a few, mild symptoms, disease is paucisymptomatic. Symptoms appearing later, after an…

Q: What is the expected result if a compromised person is exposed to a true pathogen?

A: The term 'immuno-compromised' refers to the condition of an individual whose immune defenses are…

Q: In what way are both of these periods similar

A: Period of Illness - It the period when signs and symptoms of disease are Markable or severe Period…

Q: Why are they called Opportunistic Diseases?

A: The immune system in our body is responsible for protecting us from any foreign particles. The…

Q: Explain how genetics influences the development of disease?

A: Genetics, investigation of heredity in general and of genes specifically. Genetics structures one of…

Q: How Virulence Factors Contribute to Tissue Damage?

A: Virulence factors refer to the molecules generated by pathogens such as viruses, fungi, protozoa,…

Q: Which is a method of transmitting pathogens from one host to another by carrying microorganisms…

A: Regardless of the reservoir, transmission can occur for an infection to spread. First, transmission…

Q: What is meant by an opportunistic pathogen?

A: A pathogen is a disease-causing organism. Microbes are found in abundance in the body. These…

Q: What is a chronic and an infectious disease prevalent in the United States?

A: Chronic diseases are the one's who's condition lasts for year or more than a year, this may require…

Q: Is it important to know about the relationship between a cause and a symptom?

A: CAUSE is defined as the reason something happened ao to make happen. A cause is the source of reason…

Q: How are acute, chronic, and latent infections different from one another?

A: Acute infection are those infections which occur in a relatively short time (rapid onset) (like in…

Q: What is the nature of infectious disease?

A: Pathogenic microorganisms, such as bacteria , viruses , parasites or fungi, cause infectious…

Q: Are there any similarities between infectious and chronic diseases

A: Introduction: Infectious diseases are caused by organisms — includes bacteria, viruses and…

Q: What is the prevention of disease?

A: A disease can be communicable or non-communicable in nature. Communicable diseases can be prevented…

Q: what can you say about nature of non-communicable disease based on its cause and effect?

A: Non Communicable disease are diseases which are not transmissible by person to person contact. Non…

Q: Which disease is known as 'silent killer'?

A: The cardiovascular system consists of muscular pumping organ called as heart and a closed system of…

Q: Write a chain of infection for a communicable disease? Not Covid

A: The process by which an infectious disease spreads in a community is called chain of infection.…

Q: what are different aspects of a disease process? define

A: There are different aspects of a disease process as different diseases depends upon different…

Q: What is the pathogenesis of ALL?

A: ALL is the type of leukemia and its full form is acute lymphoblastic leukemia. It is the most common…

Q: Explain the relationship between the infection chain and transmission of infection ?

A: All elements of the infection chain must be present for an infection to occur. Transmission is a…

Q: IF A PERSON IS INFECTED BY THE SAME PATHOGEN A SECOND TIME , why does the person either not get sick…

A: Immunology is the study of the immune system and its response to infections. The immune system…

Q: Describe the germ theory of disease.

A: Along the lines of understanding the causative of diseases by the humans, various theories were…

Q: Which is a method of transmitting pathogens from one host to another by carrying microorganisms…

A: Transmission can occur regardless of the reservoir, allowing an infection to spread. First,…

Q: What is the Factors That Alter the Resistance to Infection?

A: The factors that alter the resistance to infection depend on the immune system of the body. The…

Q: What are the impacts of disease on the individual, family, economy, society, nation, and the world?

A: Disease an illness of the body in humans, animals or plants. A disease is a particular abnormal…

Q: differentiate between a viral infection and a bacterial infection?

A: Living organisms that are not visible to human eye but can be observed under a suitable microscope…

Q: Why are pathogenic disease referred to as transmissible disease?

A: The condition of complete well-being of social, physical, and mental condition is termed as health.…

Q: How is it that we are not in a state of continuous infection from the microbes we encounter every…

A: Immunology is the branch of science which deals with the study of the immune system, immune response…

Q: Model disease processes and explain virulence

A: Introduction: A disease model is an animal or a cell that has pathological processes the same or…

Q: Which heritable changes are possible, given the constraints imposed by the necessity of the organism…

A: Introduction Evolution is the key process which regulates the survivability and continuity of…

Q: Distinguish between infection and disease.

A: Human health is related to overall fitness of the body. This fitness of the body sometimes gets…

Q: What factors influence the body’s resistance to infection?

A: The body's resistance to infection includes the ability of the body to fight against the infection.…

Q: Why is H5N1 avian influenza considered a majorthreat to public health?

A: H5N1 is a type of influenza virus. They belong to the family Orthomyxoviridae, and they are…

Q: Difference between symptoms and signs of a disease?

A: Infection is a specific strange condition that contrarily influences the construction or capacity of…

Q: What is major difference between an endemic disease and an epidemic?

A: Answer: EPIDEMIC : It is the spread of disease within a population , region and a community. ENDEMIC…

Concept explainers

Health Epidemiology

Health is an essential factor for all human beings. For all humans, health is a critical factor. An individual's ability to meet life's challenges and retain his or her capacity for optimal functioning is reflected in his or her condition of health. This needs the physical, mental, and biological parts of one's constitution to maintain a degree of functioning that has a favorable influence and support for one another.

Question

Is this a graph of an acute, chronic or latent disease?

Period of
illness
Period of
decline
Most severe
Signs
and
signs and
symptoms
symptoms
Time
Number of microbes
Incubation period (no signs or symptoms)
Prodromal period (mild signs or symptoms)
Period of convalescence

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Part I – SymptomsCallie was 26 years old when she opened a bakery called “Callie’s Cupcakes” in downtown San Francisco with herf ancé, Jeremy. Despite the competitive market, her business was booming; everyone loved the clever recipes and thetrendy atmosphere. Between running their fast-growing business and planning for their wedding, Callie hadn’t beenable to keep to her usual eight hours of sleep a night. Although she had always lived a very healthy lifestyle, exercisingdaily and eating healthy, she just hadn’t been feeling herself lately. She was tired all the time, had dif culty breathing,felt stressed, coughed up sputum, consistently ran a low-grade fever, and had lost weight as her appetite decreased.None of these symptoms alone had been particularly alarming so she had put of seeing her physician for a few weeks.Questions1. What are Callie’s symptoms? List all that were mentioned.2. Based on the symptoms presented, what are three possible respiratory infectious diseases Callie…
If a person becomes ill and the symptoms indicate infectionby a parasitic organism, treatment will depend upon correctdiagnosis of the problem. What category of anatomic studywould be most appropriate for identifying an infectious agentin the blood or muscle tissue? What kinds of effects would aninfection in the blood or muscle tissue have?
Cenvas quco O Mucous membranes are quite thin and fragile. How can such delicate tissue provide defense against microbial invaders? O The mucus secreted by the mucous membrane physically traps microbes. O Both the mucus and the outer layer of cells are shed frequently. O The mucus is a physical trap that contains a variety of antimicrobial chemicals. O The mucus physically traps microbes, contains a variety of antimicrobial chemicals, and is shed constantly, along with the outermost layer of cells. Question 6 A major outcome in response to the is the production of O complement cascade activation; a MAC in which a hole is built in the cell wall. O adaptive immune system; dendritic cells. O innate immune system; antibodies. O NOD activation; complement system.
Huntington’sdiseaseisanautosomaldominantconditioninhumans.Thediseaseis oftennotdiagnoseduntiladulthood,sometimesafterthepersonhashadchildren(and possiblypassedtheHuntington’salleletotheirchildren).PeoplewithHuntington’s diseaseareusuallyheterozygousandnothomozygousdominant.Assumethataperson withHuntington’sdiseasehasachildwithapersonwhodoesnothaveHuntington’s disease.WhatistheprobabilitythatthechildwillhaveHuntington’sdisease?Support youranswerwithaPunnettsquare(onnextpage).
Period of illness Period of decline Most severe Signs and signs and symptoms symptoms Time Copyright O 2010 Pearson Education, Inc You just defined acute disease, chronic disease, and latent disease. Answer the following questions. Q1) What type of disease does the graph ( shown above) seem to represent? Q2) Once you have identified what type of disease the above graph represents, draw graphs for other two types of diseases showing different stages of growth period Q3) List microbial diseases that is an example of acute disease, chronic disease and latent disease Number of microbes Incubation period (no signs or symptoms) Prodromal period (mild signs or symptoms) Period of convalescence
partor the normal mlcroblota tnroughout one's life. Bacteria that have a parasitic relationship with their human host. Question 3 A patient suffers from conjunctivitis due to E. coll moving from the colon to the eye. What type of Infection does this describe? O An opportunistic infection that is the result of introducing normal flora into an unusual site in the body. O Aresident infection that is the result of introducing normal flora into an unusual site in the body. O An opportunistic infection that is the result of suppressing the immune system. O Atraditional infection tthat is the result of introducing normal flora into an unusual site in the body. Question 4 mobility-print-cli.msi mobility-print-cli.. IMG 6845.jpg MacBook Air
forboad-spectum cverge r se neumonia Heisunstade and apast serous) C Clulte C scatnine deance e Estimatea lanomycin manterance ose and ntenal for C Rund othe nere 20mg
This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
Describe refsum's disease .
K Miloura Paul - Biology_Unit 4 Pc X Seplquatic volve Sel Ciline fcal th CareX : m cceaianment A web.kamihq.com/web/viewer.html?state=%7B"kds%3A%5B 1 jGujPYSxQlex4AFCn8zftVSgM5PIG%5D%2C*action"%3A'open%2C'userld %3A"1129860039 E Miloura Paul - Darw. 100% A Kami Uploads Miloura Paul - Biology_Unit_4_Post_QuizEnzym Student Version pdf Cells in the stomach produce pepsin, an enzyme, to help digest food. Pepsin works best at a pH of 2. Which of these graphs most likely shows what will happen to the activity of pepsin as the pH of the stomach is increased? 2. EFFECT OF pH ON PEPSIN ACTIVITY A. EFFECT OF pH B. ON PEPSIN ACTIVITY pH pH EFFECT OF pH EFFECT OF pH ON PEPSIN ACTIVITY C. ON PEPSIN ACTIVITY pH pH DELL 23 2$ & 4 7 Pepsin Activity Pepsin Activity 5 Pepsin Activity Pepsin Activity CO
A research scientist is developing a new antimicrobial drug for a pharmaceutical company. Discuss at least 4 attibutes that this drug should posses in order to be an ideal antimicrobial drug.
What is the clinicaldeficiency presented byhemophilic people? What isthe genetic cause of thatdeficiency?