Q: Why do we think that the forest communities of eastern North America have changed dramatically over…
A: Ecological succession is the process by which an ecological community changes and develops over time…
Q: Which of the following is/are ways in which a single hormone can have multiple effects? There could…
A: Hormone are signal molecules that are produced by endocrine glands and bind to a specific receptor…
Q: Lamin polypeptides (nuclear lamina) form dimers in which the central α-helical regions of two…
A: The nuclear lamina, a network of intermediate filaments lining the inner surface of the nuclear…
Q: What is Favipravir(c5h4fn3o2) used for? What could be the predicted open structure of the palladium…
A: The antiviral drug favipiravir (C5H4FN3O2) is used to treat influenza and a few other viral…
Q: What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…
A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…
Q: An amino acid mutation in the voltage-gated sodium channel that caused the voltage gate helices to…
A: Amino acids are organic compounds that are the building blocks of proteins. They contain an amino…
Q: You isolate bacteria from several different pools at the recreation center. Curious about which…
A: BLAST are the tools that are used to identify the differences and similarities between the protein…
Q: Imagine two populations of fish who are part of the same species. Though they are the same species,…
A: Genetic Variation refers to the difference in the genetic make up of individuals present in a…
Q: Memory formation depends on the synaptic plasticity of the hippocampal synaptic pathways. True False
A: Synaptic plasticity refers to the ability of synapses, which are the connections between neurons, to…
Q: An enzyme consists of 1 polypeptide chain only and has a molecule weight of 30,000. Assuming the…
A: The given information is: The enzyme consists of 1 polypeptide chain only. The molecular weight of…
Q: If 3.8% (w/v) of sucrose is needed in the media, how much of sucrose is required to prepare the…
A: Sucrose is a common disaccharide (a molecule composed of two simple sugar units) that is often…
Q: Give typing answer with explanation and conclusion Briefly define each of the following terms in…
A: The answers of all the 3 questions are provided in the next step
Q: explain some ways to decrease caffeine in your life.
A: Many foods and drinks contain caffeine, a natural stimulant. It is a member of the xanthines…
Q: Why is the application of ice a useful therapy for inflammation?
A: Inflammation is defined as the immunological response of the body tissue against the pathogens or…
Q: Provide an example of a passive immunity created artificially. How does the vaccinated person gain…
A: Artificial passive immunity is a form of immunization that involves the administration of pre-formed…
Q: A. Find information from 1 of the 3 sizes that are below Small 1.finches 2. Parakeets Medium…
A: Restriction refers to a method of immobilizing a bird, such as a Cockatiel, to prevent it from…
Q: Can an organism that doesn't utilize citrate grow on the Citrate agar we use in class? O It depends.…
A: Microorganisms are the tiny organisms that cannot be seen as such through naked eyes but require…
Q: 14. What is the limit for intake of saturated fat recommended by the Dietary Guidelines for…
A: Dietary fats include saturated fat. In addition to trans fat, it's one of the most harmful fats.…
Q: What is parsimony? an element that decays from antimony, used for radiometric data of fossils. a way…
A: A branching diagram or "tree" illustrating the evolutionary links between several biological species…
Q: In aphids, some female clones have wings and others do not. This is an example of: A) Polyphenism B)…
A: Aphids are small, soft-bodied insects that belong to the superfamily Aphidoidea, within the order…
Q: Which of the following resource(s) do plants need to survive (select all that apply): A. O2 for…
A: Plants are autotrophic organisms that can produce there own food by trapping the solar energy. They…
Q: List all the environmental impacts that occur during the "life span" of gasoline; that is, from…
A: Gasoline, also known as petrol, is a liquid fuel derived from crude oil that is used to power…
Q: What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen…
A: Five Promo Russell is a mutagenic analogue of the mean that can incorporate into DNA during…
Q: A researcher performs a tissue transplant experiment with an early Drosophila embryo. The researcher…
A: One of the most crucial elements in ensuring the success of any organ transplantation is ensuring…
Q: cetylcholine binds to a GPCR on heart muscle, making the heart beat more slowly. The activated…
A: Acetylcholine slows the heart rate by activating the M2 muscarinic receptor. It opens the…
Q: An individual has the following reciprocal translocation: B CDE H B CDE H A J e. What is the name of…
A: When two non-homologous chromosomes exchange their chromosome segments, the resulting chromosomal…
Q: The holes in Swiss cheese are caused by Air pumped into the cheese during the aging process. Carbon…
A: Swiss cheese is a type of cheese that is known for its distinctive appearance, with large holes or…
Q: at acts as The figure on the left shows four populations (black partial dispersal (grey line). Match…
A: Theory of island biogeography: According to the theory of island biogeography, the number of…
Q: Question 1. Describe an action potential in a muscle fiber in detail, know the changes in voltage…
A: An action potential is a brief electrical signal that travels along the membrane of a neuron or…
Q: Answer the questions below to help you write your case summary. 2. Use the scroll bar on the right…
A: Kidney failure is also known as renal failure which can be diagnosed through a combination of…
Q: The number of bacterial cells increases from X to 32,000,000 in 2 hr. The generation time is 20…
A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…
Q: A common misconception about mutations is that they are always harmful. What mutation effects on an…
A: A mutation is a change that occurs in the DNA sequence of a gene or a chromosome. Mutations can be…
Q: 5' new 11. A. Which end of a newly generated DNA strand is unable to replicate a short segment of…
A: Deoxyribonucleic acid also known as DNA, is a molecule that contains the genetic instructions…
Q: Antiretroviral drugs target various aspects of HIV replication and infection. Which of the following…
A: A combination of medications known as antiretroviral therapy (ART) works to stop several stages of…
Q: Consider the below transporter: for 2 Na+ that get in 1 molecule of glucose enters. What is the…
A: To determine the maximum ratio of glucose concentration, we need to consider the equilibrium state…
Q: If an individual has an autosomal dominant/complete dominant form of hypertrichosis, which of the…
A: Autosomal dominant conditions are the genetic conditions that are carried on the chromosomes of…
Q: On picture number 1, what bacteria has that hemolytic activity result? 1 Staphylococcus epidermidis…
A: A gel or liquid that contains nutrients which is used to cultivate bacteria or other microorganisms…
Q: Give three examples of female sexual selection for ornamentation in males and explain how preference…
A: Females choose partners based on particular qualities or behaviours that are regarded as…
Q: 17.1 Section Review 1. Classify each organism as either an invertebrate or a vertebrate. a. sponge…
A: Vertebrates and invertebrates are two major groups of animals. Vertebrates are animals that have a…
Q: differences between Mendelian inheritance and blending inheritance.
A: Inheritance refers to the passing down of genetic information from one generation to the next. This…
Q: What is the level of organization in the human body from least to most complex?
A: The level of organization refers to the hierarchical structure of living things, from the simplest…
Q: Which of the cells in the hematopoietic stem cell niche MOST directly contributes to the maintenance…
A: Hematopoietic stem cells (HSCs) are responsible for generating all blood cell types throughout an…
Q: What immune defense would be most impacted for a patient with a C9 complement protein deficiency? Be…
A: The complement system is a complex network of proteins that play a vital role in the immune…
Q: If we watched a eukaryotic cell initiate translation, one of the first things we would see is a.…
A: Transcription is the process by which the information in the gene is coded into a mRNA (messenger…
Q: How does energy movee through an ecosystem from one trophic level to the next and what is the…
A: Energy flows unidirectionally through an ecosystem. It enters the food chain through primary…
Q: Which is the correct transcript of this section of DNA? TAC GCG CCT AGG GGG TGG AUG CGC GGA UCC CCC…
A: DNA (deoxyribonucleic acid) is the genetic material that carries the instructions for the…
Q: Which of the following is wrong for the description of protein synthesis (A) The large ribosomal…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Which of the following takes place during the depolarization stage of an action potential? OK+…
A: The action potential is defined as the sudden increase in the excitation of neurons and muscles…
Q: The following chromatogram is obtained from the sequencing reaction. Using the key below, what…
A: Saccharomyces cerevisiae or Baker's yeast is used as tool in various genetic experiments. This is…
Main question I need for notes: If evolution is true then why do new species seem to appear out of nowhere in the fossil record?
Please answer the question below the picture if possible, thank you.
Step by step
Solved in 3 steps
- Imagine that you have the DNA sequences fromthe intron of a gene in three species called A, B,and C. Species A and B are most closely related,while C is more distantly related. The sequencesof A and B differ by 18 base pairs, A and C differby 26 base pairs, and B and C differ by 28 basepairs. Fossils show that species A and B divergedabout 1.2 Mya, but there is no fossil evidence asto when the most recent common ancestor ofall three species lived. Use the genetic data toestimate that date. What assumptions are youmaking to get this estimate?What must be TRUE of any organ described as vestigial? It need be neither homologous nor analogous to some feature in an ancestor. O It must be analogous to some feature in an ancestor. O It must be homologous to some feature in an ancestor. OIt must be both homologous and analogous to some feature in an ancestor.How did all the different body types in the Cambrian arise so quickly? O Hox genes had evolved that determine and allow for the diversification of body plans. Because Hox genes hadn't evolved yet, there was a lot of flexibility in how body plans could develop. O There was a genome duplication event that led to the diversification of body plans. Enhancer driven gene expression had just evolved, which made it easier to vary body plans. Toing wheroptiones 29
- Snakes evolved from ancestors who had the ability to walk. Some snakes, in fact, still have small pelvis and leg bones that are rermnants from this ancestor. What are these called? * O Vestigial structure Homologous strucre O Sympatric structure Molecular homologyEvolution of Whales This is an example of how microevolutionary changes eventually result in the formation of a by macroevolution. 1. How many species are in the diagram? 2. What living animal are whales most closely related to? 3. What happened to whales' closest cousins? Outgroup Masonychia Perissodactyla Gujaratia pakistanensis Wasatchian Diacodexts Homacodon Tylopoda Sulformes Ruminantia Anthracotheres Cebochoerus Hippopotamids Khirtharia Indohyus Cetacea Distantly Related Mammal Extinct Ancestor Group Rhinos, Horses, Tapirs Pigs Cows/Sheep Hippos Extinct Artiodactyl Extinct Whale "Cousin" Modern WhalesA вс D E F G scales fur/ scales spikes horns horns claws feathers hair a) Which trait(s) did the most recent common ancestor of dragons A and B have? [ [ Select ] b) Which trait(s) appear to be the result of convergent evolution? [ Select ] c) Which trait(s) does dragon D have? [Select ] d) Which taxa is most closely related to dragon B? [ Select ] f) True or false? The clade formed by dragons D, E, and their most recent common ancestor is monophyletic [ Select ] e) Which trait(s) did the most recent common ancestor of dragon species A and E have? [ Select ]
- Why was the Cambrian era most unique among the fossil record of animal evolution? O Soft bodied animals fossilized only in this era. O Speciation of animals occurred only in this era. O All basic animal body types present today were found in this era. O Animal fossils are found only in this era.In the late 1800's, a biologist studying animal embryos coined the phrase, "ontogeny recapitulates phylogeny", meaning that the physical development of an animal embryo (ontogeny) seemed to retrace the changing form of the species during its evolutionary history (phylogeny). Why would embryonic development retrace evolutionary steps?Segmentation has evolved several times and occurs in most animal supergroups. What advantages do segmented taxa have over their unsegmented relatives?
- What are the most fundamental (oldest) characteristic(s) in the evolution of these animals (EMU, Liver fluke, Octopus, polar bear, raw pore rope sponge, and green frog).The fossil record is biased because... Actually, this bias is only perceived; older eras had completely different body plans which makes it look like a lot of fossils are missing, while instead they existed. O Fossilization only happens under dry, arid conditions, which is most common in limited, desert like conditions. O The decomposition of an organism needs to slow down to increase chance of fossilization, which only happens under certain conditions. O Only organisms living in the deep ocean have a chance of fossilizing, because those are ideal conditions. 29 In TOIs the fossil record a complete picture of all of the living things that have ever existed on earth? Why or why not?