Q: 1. The pedigree below is for a rare but relatively mild hereditary disorder of the skin. How is the…
A: Pedigree represents a family chart that shows the inheritance pattern of traits in different…
Q: The following is an independent type of life: O a. Organ O b. Organelle O c. Organism O d. Organ…
A: Life is defined as any system capable of performing functions such as eating, metabolizing,…
Q: Which of the following marks an important event during telophase? Onuclear envelope starts to…
A: Cell division is the process of dividing parent cell into its daughter cell . This division are of…
Q: Which of the following modifications of the Epithelial Growth Factor Receptor (EGFR) would be…
A: Epidermal growth factor receptor is a transmembrane protein that spans the length of the cell…
Q: Mentions the advantages of membrane bioreactors in water treatment
A: Membrane bioreactors (MBRs) combine membrane technology with biological processes to clean…
Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…
A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…
Q: PURPLE VESTIGIAL DIHYBRID CROSS In the parental generation, you mate a pure-breeding wild-type…
A: Introduction A dihybrid cross is made up of two individuals who have two features that are…
Q: Explanation of the operation of the membrane bioreactor
A: Explanation: A membrane bioreactor, often known as an MBR, is a technique for treating wastewater…
Q: method/s employed for each given algal species. Vegetative: binary fission, fragmentation, etc.…
A: Vegetative reproduction is a type of reproduction that involves any vegetative part to reproduce the…
Q: A researcher sequences the Pitx1 gene in a population of 100 stickleback fish that is known to…
A: Hardy-Weinberg Equilibrium is a concept that biologists use to analyze gene evolution in a certain…
Q: 1) Explain what is the role of PTEN in the regulation of cell cycle/growth and how does it lead to…
A: Introduction The cells are the basic units of the living organisms that take part in various…
Q: List one advantage and one disadvantage of conjugation in Paramecium: Advantage: Disadvantage:
A: Introduction Conjugation is a process by which one bacterium transfers genetic material to another…
Q: researcher would like to evaluate the claim that a new drug, "Acne Buster" can help individuals…
A: There are mainly four types of research methods. They are observational, correlational, experimental…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: The image of these living HeLa cells are most likely from:
A: Different types of microscopy are used in the magnification and imaging of cells. Some routinely use…
Q: In 1887 a strange nerve disease attacked the people in the Dutch East Indies. The disease was…
A: * Dr. Eijkman conducted experiment on the chicken to find out the reason behind the nerve disease…
Q: During metaphase, what may happen if spindle fibers (kinetochore microtubules) will not be attached…
A: Mitosis is a type of cell division in which one cell (the mother) divides to produce two new…
Q: Hemoglobin has a molecular weight 16,000 Daltons. convert hemoglobin concentration from 13 g/dL to…
A: Given , Hemoglobin molecular weight= 16000 Dalton Convert Hb concentration from 13 g/dL to mM/L
Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase? O DNA…
A: Introduction Life is based on cell division and cell cycle. Cell cycle and cell division are…
Q: Which of the following could be a reason(s) why a signalling cascade is interrupted, or turned…
A: It is true that cellular signalling follows a cascade of events and has multiple points of…
Q: Evidence supports that feathers evolved before flight, and were later co-opted for flight. This is…
A: Any net directional change or cumulative change in the characteristics of organisms or populations…
Q: You are administering 0.6 g of an IV medication which is available as 1 g in 3.6 ml. How many ml of…
A: The application of a drug in an organism is very critical and we need to follow the proper…
Q: 7. 1 Required Study the two diagrams below. Diagram A 1 2 Diagram B 2 Based on the sequence of steps…
A: Active transport is a type of transport process that helps to move molecules through the cell…
Q: what do you think is the coolest metabolic process for energy-producing nutrients?
A: All living organisms require energy for various living processes such as growth, reproduction,…
Q: If you plate 200 ul of a 1:100,000 dilution and get 123 colonies, what is the number of CFU/mL in…
A: CFU or the Colony Forming Unit is defined as the unit that gives an estimate of the number of viable…
Q: In which stage of the cell cycle do cells grow and accumulate all necessary molecules in preparation…
A: Cell division is a phenomenon in which parent cell splits off and gives rise to novel cell . Number…
Q: A patient came to the clinic with a complaint of malaise. She said she’s been feeling week since the…
A: Introduction Anemia is a disorder in which there are insufficient healthy red blood cells to…
Q: Draw the cladogram for "organisms" A-J of the family "Boltidae". Include each of these letters and…
A: Cladogram is a branching diagram which show the cladistic relationship between a number of organisms…
Q: Differentiate Brownian movement and true motility
A: All living things, including microbes, require movement. They prefer beneficial substances such as…
Q: The moray eel and cleaner wrasse story at the beginning of the chapter is an example of which type…
A: The study of the relationships between living species and their physical surroundings to uncover key…
Q: Describe kinases and cyclins. How do they interact to cause cellsto move through the cell cycle?
A: Cells must duplicate their DNA before they divide in order to pass an identical copy of their…
Q: Define about Tobacco Smoke and Cancer ?
A: Cancer describes conditions where aberrant cells proliferate uncontrollably and have the ability to…
Q: Question 36 Drosophila Experiment In Drosophila melanogaster (also known as fruit flies), wild type…
A: Given Wild female fly (red eye) Mutation male fly (white eye) Red eye is dominate White eye is…
Q: 1. Graded potentials are short lived and travel only short distances. Action potentials are long…
A: Graded potential: its the change in electric potential across the membrane of an excitable cell like…
Q: Consider molecule #1. How does the term amphipathic relate to this molecule? It is a large nonpolar…
A: Compound lipids are fatty acid esters containing additional groups such as phosphate sulphate sugar…
Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…
A: The cell cycle, or cell-division cycle, is the series of events that take place in a cell that cause…
Q: Which manifestations of liver disease are due to hepatocellular failure and which are due to portal…
A: Liver disease Applies to many conditions that stop the liver from working or prevent it from…
Q: There are large endocrinocytes in the wall of the follicles and in the interfollicular layers of the…
A: A important hormone gland, the thyroid gland is important for the growth, development, and…
Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase?…
A: Introduction Strasburger 1875 first reported the presence of chromosomes in eukaryotic cells.…
Q: What does translucent spot mean with regards to lipid? Identify the control for this test. 1.…
A: Introduction Lipids are macromolecules like proteins, nucleic acids, and carbohydrates. These are…
Q: What is the relationship between cholecystitis and cholelithiasis?
A: Gallstone disease is the most common disorder affecting the biliary system, which is the body's bile…
Q: Show the gametes produced by illustrating the phases of meiosis (a) AAbbCc (b) AaBbCcDd
A: Introduction : Gametes are also known as sex cells. An individual's gametes are their reproductive…
Q: Which model did scientists develop to describe the cell membrane
A: Cell membranes are biological obstacles that hinder medication molecules from passing through. Not…
Q: importance of understanding the nature of drugs and medicine
A: Introduction :- a dose form with one or more active chemicals as well as potential inactive ones.…
Q: Give a detailed description of the structure, characteristics, and functions of proteins.
A: Proteins are the class of complex, nitrogenous, organic compounds composed of amino acid residues…
Q: Provide two plausible explanations for why the S allele persists after five generations.
A: Sickle cell anemia It is a autosomal recessive disorder which is inherited from parents to their…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…
A: A checkpoint is a stage in the eukaryotic cell cycle where the cell examines internal and external…
Q: Based on the ORGANIZATION of neurons, why are some areas of skin more sensitive than others
A: Neurons are the basic structural and functional unit of nervous system. These are capable of…
Q: I studied microbiology in the fifth semester of medical school. I studied medical mycology as one of…
A: Introduction The study of microscopic creatures' biology includes viruses, bacteria, algae, fungi,…
Q: Explain the impact of nitrosamines ?
A: Nitrosamines are organic compounds with the chemical formula R2N-N=O, where R typically represents…
Step by step
Solved in 2 steps with 1 images
- Analysis of a protein is taking place. The enzymic acivity of this protein is stable up to temperatures of 40 degrees celsius. ph values are between 2.5 and 11.5. Now, Ion exchange chromatography is conducted via a software using DEAE-cellulose and method of elution is done by salt gradient. pH is set to 7. In terms of Molar, start of gradient is 0 and end of gradient is 1. The following graph is generated. Using the graph and analytical methods, determine pI of protein.Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH = pI pH = 7 pH = pKa In size exclusion/gel filtration chromatography, the elution order is dependent upon Molecular weight Concentration Overall Charge Enzymatic ActivityHow does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought the answer was that NH4S04 attracts H2O so the protein doesn't bind to H2O allowing the protein to bind to each other. But the answer given is, orders water locally to become more ice-like. Can someone explain?
- 1) If the pH of the rain drops from 6 to 5 due to air pollution, the rain has become: a) two time more acidic b) four-time more acidic c) ten time more acidic d) one thousand times more acidic 2) which of combination of statement is correct ? the denaturation of protein 1- causes changes in tertiary structure 2- is always an irreversible process 3-has no influence on the solubility 4-occurs only by interaction with heavy metals 5-does not influence covalent bonds and hydrogen bonds select one: a) only 1 is correct b) only 1 and 2 are correct c) only 3 and 4 are correct d) only 3, 4 and 5 are correct e) only 1, 2 and 5 are correctThe amino acid shown below has an ionizable side chain with a pka of 4. When this amino acid is in a more basic solution (i.e., pH 11), it would resemble ionization state C and have a charge of -1 HO OH NH₂ lonization state A NH3 lonization state C HO OH NH3+ Ionization state B dyb NH₂ lonization state D1. Complete the table below with information about the amino acids utilized in this pro- cedure. Remember that smaller amino acids will travel further and so will amino acids that are soluble in the solvent. Table 9-1. Amino Acids Procedure AMINO ACIDS Phenylalanine Aspartic Acid Leucine Proline matemps DRAW THE MOLECULAR STRUCTURE in POLARITY (IS IT POLAR OR NONPOLAR?) odme her basalu la MOLECULAR WEIGHT SIZE (RANK LARGEST = 4 AND SMALLEST = 1) SHOULD IT REACT WITH NINHYDRIN?
- A protein has an isoelectric point at 6. It is soluble at what pH?Would each of the following ions of serine exist at a pH above, below, or at its pI? Drag the appropriate items to their respective bins. Above pl H₂N-CH-COO CH₂OH H₂N-CH-COOH CH₂OH Below pl H₂N-CH-COO CH₂OH At its pl Reset HelpWhich of the following levels of protein structure may be affected by hydrogen bonding? (a) primary and secondary (b) primary and tertiary (c) secondary, tertiary, and quaternary (d) primary, secondary, and tertiary (e) primary, secondary, tertiary, and quaternary
- Three proteins with an overall charges of 0, -5, and -8 are passed through an anion exchange column equilibrated in a buffer with low ionic strength and eluted with an increasing gradient of salt in a buffer. Which protein will elute last from the column? 1. Protein with no charge. 2. Protein with eight negative charges. 3. Protein with five negative charges. 4. Both charged proteins will elute at the same time. O 2 O 4 O 3 O 1Fill in the blanks 1) The interactions between biomolecules and, proteins fold, and are exerted through the_ molecules organize themselves around letronrany. in are the most critical determinant of how Effect. This is observed when, atomic surfaces causing an unfavorable change which leads to these surfaces clustering, where they interact via (interatomic) interactions. The primary interatomic interactions that contribute to stabilizing folded proteins are and In addition, rotations about single bonds energies. The Ramachandran plot determine conformations and contribute to. (which atoms?) of the indicates the energetically favored conformations for the. polypeptide. The 3-D path of this (last answer) defines the. of the protein. 2) There are two types of "regular" secondary structure elements in folded proteins, and have low energy backbone and satisfied, in the backbone atoms.. In alpha helices, the atom of the ith residue forms an H-bond with the atom of the i+ residue. In (two…The addition of ethanol, CH3CHOH, t an aqueous solution lowers the surface tension of the solution. Predict whether adding ethanol to an aqueous protein solution will tend to stabilize or unfold the protein. Briefly explain.
