Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: discuss , the relationship between cell viability and cell vitality and cell apoptosis as suggested…
A: * Cell viability is ratio of initial cell number to ratio of dead cell number * A viability assay…
Q: Racoons have rings around their tails and a habit of washing their food in water before eating it.…
A: * Given that Wide bands on tails are BB Medium bands on tails are Bb Narrow bands are bb *Wash…
Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…
A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…
Q: You are performing an experiment with liquids on your backyard. One morning, you observed that the…
A: INTRODUCTION Gene code is the sequence of nucleotides in DNA and RNA that codes for particular amino…
Q: 70% On day 4, how do you think the patient was feeling? How do you think this factored into her…
A: Antibiotics are drugs which are used to prevent or treat bacterial infections. They operate by…
Q: How similar are the daughter cells each process (meiosis and mitosis) makes?
A: Meiosis and mitosis are the types cell division.
Q: Because of oxygen and nutrient requirements, cells in a tissue must reside within 100 μm of a blood…
A: Mammalian cells require nutrients and oxygen to survive, so they are found within 100 to 200 mm of…
Q: Why are some fungi grouped under "fungi imperfecti"?
A: Introduction In this question we will discuss why some fungi grouped under " fungi imperfecti".
Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…
A: Mutation can be divided into several categories. The types of mutation include missense mutation,…
Q: Describe the six steps in antigen processing and presentation via the class II MHC pathway.
A: MHC II uses the exogenous pathway for antigen processing and presentation for antigen presentation.…
Q: Give examples, names the three main inflorenscene types of grasses
A: A group or cluster of flowers formed on a stem made of a primary branch or a sophisticated pattern…
Q: Arthropods are distinguished by having an exoskeleton andlacking external cilia. How do these traits…
A: The exoskeleton is the hard chitinous covering that covers the body of insects and prevents it from…
Q: Is a bacterial operator a binding site?
A: Introduction:- Other DNA sequences, in addition to the coding region of a gene, are essential for…
Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…
A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…
Q: In addition to anaerobic bacteria which other two examples did the narrator state that anaerobic…
A: Here I will give the two other conditions or states of anaerobic conditions.
Q: the following data could the man be the father of the 3 children? please write complete answer and…
A: In a single cell, half genome is from father side while other half is from mother side.
Q: How do you properly write the scientific name using binomial nomenclature of the new species?
A: Binomial nomenclature The binomial nomenclature is a scientific method for naming newly found…
Q: Why is the epithelial tissue characterized as polar sheets? answer and explain
A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…
Q: Explain the difference between aerial and basal tillers
A: Introduction : Tillers are branches develop from leaf axils of each unelongated node of shoot.…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: INTRODUCTION Reproduction is the method of producing offspring of an individual via fusion o gametes…
Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…
A: Answer
Q: 6. Which of the following structures are regulated by autonomic nervous system? A. Epidermis, heart…
A: Autonomic nervous system is a component of peripheral nervous system that controls involuantory…
Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…
A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…
Q: Define 'oestrus' and 'menstrual cycles.
A: There are a few key ways that pregnancy and the menstrual cycle are related. First, both involve the…
Q: Now consider alanine as a whole molecule. Use the Ka values from the chart above, and your…
A: For alanine, the pKa1 value is 2.35 the plan value is 9.87 The isolectric point is the pH at which…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…
A: Introduction:- A one pair of alleles described the similar trait, for example, eye color ; one…
Q: Which condition, aerobic or anaerobic, yields more energy (ATP) ?Why do you think this is ?
A: Respiration It is amphibolic and exergonic cellular process. Multistep enzymatic process. Metabolic…
Q: A benefit/benefits of vaccination is that a child will O protect other children who cannot be…
A: Answer : the benefits of vaccinations is that Child will are : develops antibodies through…
Q: For some traits, one allele is not completely dominant to another. Incomplete dominance occurs when…
A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…
Q: 1. What are the target cells of SARS-CoV-2? What do these cells have in common?
A: Many scietific studies have confirmed that SARS-CoV-2's spike protein attaches to…
Q: what is the purpose of calcium ion in fertilization?
A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…
Q: The liver is known for its ability to remove certain toxins from the blood. It can it is made up of…
A: Lysosomes are membrane-enclosed organelles that contains digestive enzymes.They are involved with…
Q: 9. The response of wild mustard to drought in the bay area shows?? a. There is genetic variation for…
A: The correct option is D.
Q: To live on a large planet with strong gravity, a cold, dry climate, and a thin atmosphere, what…
A:
Q: Temperature-dependent sex determination (TSD) is the method of sex determination in sea turtles. In…
A: The answer to this question is solved in serial wise. A) Cellular Events
Q: What are pressure sores or decubitus ulcers? Discuss some instances how this can occur to a patient?
A: Bedsores — also called pressure ulcers and decubitus ulcers — are injuries to skin and underlying…
Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…
A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…
Q: In philodendron plants, what do you call a formation of aerial root?
A: Philodendrons are native to tropical rainforests where they ruggedly climb up trees.
Q: The Hardy–Weinberg principle may be applicable if (a) the population size is small (b) migration…
A: Introduction:- In the absence of any evolutionary impacts from one generation to the next, the…
Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?
A: The answer is YES.
Q: Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: what steps will be appropriate if the cavity has only 0.5mm of remaining dentin before entering the…
A: Dentin is the part of the tooth that is beneath the enamel and cementum. It contains microscopic…
Q: Give 3 examples each on plant and animal hybrid species and provide details on parental species, the…
A: Hybridization is the technique of mixing complementary single-stranded DNA or RNA molecules and…
Q: . What are heterogametes? What do we call these gametes individually?
A: Heterogametes are conjugating gametes that differ in their form, length, shape, or sexes, among…
Q: The feature of cells in epithelial sheets that prevents mixing of the apical and basolateral…
A: Epithelial is the type of tissue that forms a covering on all internal and external surfaces of…
Q: 5. In the following data, could the man be the father of the 6 children? Father Mother Children…
A: "Inheritance" is the process through which a child gets genetic information from his or her parents.…
Q: The genes that codes for the creation of certain blood groups are located on chromosome "XGp22.3",…
A: *Chromosomes can be found in nucleus which are thread like structures located present in both…
Q: Jim showed a prolonged clotting times and excessive bruising that are related. Again, referring to…
A: Alcohol is a hepatotoxin that is widely consumed around the world. Excessive or harmful alcohol use…
Step by step
Solved in 3 steps
- Identify the zwitterion below and at what pH it can be foundWhich of the following is NOT characteristic of the glycocalyx found in bacteria? Select one: A) a structure that can be visualized using an acidic negative stain and a basic counterstain B) creates a slimy, slippery coating that prevents bacteria from attaching to surfaces C) if firmly attached, contributes to bacterial virulence D) a viscous coating surrounding the cell made of polysaccharide, polypeptide, or bothDifferntiate between dianoflagellates and eulenoids?
- Enteric bacteria, lactic acid bacteria, and propionic acidbacteria have distinctive metabolic traits that can be used tocharacterize and identify these organisms. Describe themetabolic characteristics of these organisms, name a genusthat belongs to each group, and indicate in what way theseorganisms can be differentiated.Characterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium C (see image) Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium C. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Vegetative cellular arrangement (grouping) Number of cells in large aggregates (colonies) Layers of trichomes in a filament Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) Latest Classification based on Algaebase (algaebase.org) Kingdom:…Characterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium E Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium E. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. EXT Vegetative cellular arrangement (grouping) Class: Order: Family: Genus: Number of cells in large aggregates (colonies) Layers of trichomes in a filament Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) wwwwwwww Latest Classification based on Algaebase…
- In the diagram below, identify the structures of a cyanobacterial cell based on the following descriptions: a) Outer cellular covering which includes: Mucilaginous layer – outermost layer covering the cell wall; protects the cell from harmful factors of the environment Cell wall – found just below the mucilaginous layer; 2 or 3-layered, the inner layer lies in between the outer wall layer and plasma membrane; the outer layer is made of peptidoglycan Innermost plasma membrane – selectively permeable membrane enclosing the cytoplasm b) Cytoplasm – found below the plasma membrane; the protoplasm which contains structures of different shapes and functions. Lamellae, which contain pigments such as chlorophylls, carotenes, xanthophylls, phycoerythrin and phycocyanin, are located in the peripheral region of cytoplasm. Ribosomes may also be found scattered in the cytoplasm. c) Nucleic material – the nucleoplasm that is centrally located in the cell and contains chromatin in the form…characterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium D (see image) Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium D. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) 7. 8. 9. 10. 11. 12. 13. 14. Vegetative cellular arrangement (grouping) Number of cells in large aggregates (colonies) Layers of trichomes in a filament Latest Classification based on Algaebase (algaebase.org) Kingdom:…Name the structure pictured below and what it produces.