n 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed again in 2017 and it was up to 250 individuals. The population growth rate is 14 coyotes per year. What is the population growth rate at carrying capacity?
Q: How SBS methods are useful for human genomes ?
A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…
Q: Dicuss a strategie for Diabetes in the UK.
A: Blood glucose is the main source of energy and it comes from the food we eat. Diabetes is a disease…
Q: Explain the relationship of osmosis to enzymatic browning in potatoes?
A: Osmosis is the process of diffusion of solvent from the region of low concentrations of solute…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: P21cip1 is small 165 amino acid protein that mediates p53 dependent G1 growth arrest.
Q: Appreciate the role of ethics in environmental science, andcompare and contrast major approaches in…
A: Environmental science is defined as the study of environment on the basis of physical, geographical…
Q: What important biological characteristics of life depend on mitotic cell division?
A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…
Q: How do nerves control every organ and function in the body?
A: Although nerves play an important part in the human body, they do not govern every tissue and…
Q: Discuss different systems of biological classification briefly.
A: Introduction In this question we will discuss about the different systems of biological…
Q: Complete the formula for the Krebs Cycle: glucose (sugar) + carbon dioxide anergy C8 ATP)
A: In case of aerobic respiration, single molecule of glucose results in the production of 38 molecules…
Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?
A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Name the guidelines for naming of organisms?
A: There are much greater number and kinds of living organisms. Is different kinds of plan animal…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: 2. Which is a better mode of reproduction sexual or asexual? Why?
A:
Q: biologists were able to estimate that, on average, only 5 fisher kits (young animals) survived to…
A: Setting fishing limits, modifying fishing methods, creating aquaculture techniques, and identifying…
Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…
A: Answer
Q: When does DNA replication occu after the cell divides O before protein synthesis O during cell…
A: Cell cycle is the series of cell division that takes place in a cell as it grows and divides. Cell…
Q: What are pressure sores or decubitus ulcers? Discuss some instances how this can occur to a patient?
A: Bedsores — also called pressure ulcers and decubitus ulcers — are injuries to skin and underlying…
Q: What is humanized mice ?
A: Introduction:- The transplantation of living cells, tissues, or organs from one species to another…
Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…
A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…
Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?
A: The genome of an organism is defined as the entire genetic information that is passed down from…
Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…
A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…
Q: Provide names of two molecular chaperons and their functions for MHC I antigen presentation pathway
A: MHC class I molecules are comprised of a polymorphic transmembrane heavy chain and a soluble protein…
Q: What biochemical mechanism underlies affinity maturation of the antibody response?
A: Antibodies mediate the adaptive immune response and are produced by plasma cells.
Q: A benefit/benefits of vaccination is that a child will O protect other children who cannot be…
A: Answer : the benefits of vaccinations is that Child will are : develops antibodies through…
Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…
A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…
Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…
A: Microevolution is the evolution that acts on a small population or in a single species and it is…
Q: Single strand invasion is promoted by Rad51 protein in Eukaryotes for repair of Double Strand…
A: Homologous recombination is the exchange of genetic material between two strands of DNA. It occurs…
Q: Name the three phases of an action potential. Describe for each the underlying molecular basis and…
A: An action potential is defined as the difference in neuron potential that occurs as a result of…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Adjusting the objective aperture is an important step to obtain phase contrast in TEM. Compare the…
A: The "objective aperture" is used for accepting a transmitted wave or one of diffracted waves to…
Q: 14 15 16 8 10 12 6. 13 17 10 11 Male Female
A: Male : * 1 is kidney * 2 is renal vein * 3 is ureter * 4 is renal artery * 5 is testis * 6 is…
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: To Determine the genotypic and the phenotypic ratios of the offspring if the guinea pigs have coat…
Q: Explain how the diameter of skeletal muscle fibers varies and what type of muscle tissue grows as…
A: A single muscle cell is made up of muscular fibres. They help in the control of the body's physical…
Q: -In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant for…
A: 1. In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant…
Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…
A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…
Q: State any five objectives of biological classification.
A: Introduction In this question we will discuss about the objectives of biological classification.
Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…
A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…
Q: QUESTION 6 A population's carrying capacity (K) is the size at which the population O is the largest…
A: Here we provide a brief explanation of carrying capacity of a population.
Q: Question:- In terms of nerve action, describe 4 different molecular components involved. And for…
A: Movement of action potential along a nerve fiber in response to a stimuli is known as nerve action…
Q: Name the guidelines for naming of organisms?
A: Nomenclature is defined as the scientific and international system of naming any organisms.
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…
A: Lowest weight = 5 lbHighest weight = 29 lbWeight difference = 24 lb 3/768 = 1/256 Four genes each…
Q: READ THIS: Notice that natural selection does not refer to indiv Trequency of adaptive heritable…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Asymmetric cell division often relies on cytoskeletal elements to generate or maintain the…
A: Introduction A parent cell divides into two or more daughter cells in the process of cell division.…
Q: The genetic description of an individual is its genotype, whereas the genetic description of a…
A: Introduction Genetics is the study of genes and heredity, or how specific attributes or traits are…
Q: 1. One mL of sludge was added to a 99 mL dilution blank. Three 1/10 dilutions were then made. From…
A: CFU/ml represents the number of colony-forming units in the sample. It gives us the estimation of…
Q: Analyze the pair of words given. Choose the best letter of another pair with the same relationship.…
A: *Mus musculus is house mouse belongs to order Rodentia having a pointed snout and large rounded…
Q: 1. Look again at the six embryos in their earliest stages. Describe the patterns you see. What…
A: Species and their anatomical changes from early stage to late stage. Human : well developed limbs ,…
Q: The MN blood group is of interest to population geneticists because (a) people with genotype MN…
A: Blood is classified into four types based on the presence or absence of antibodies and antigens on…
In 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed again in 2017 and it was up to 250 individuals. The
Step by step
Solved in 2 steps
- In 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed again in 2017 and it was up to 250 individuals. What is the growth rate of the coyote population? What will the population size be in 2025?A coyote population in Colorado has 40 individuals, the potential reproductive rate per individual per year is 1.5, and the carrying capacity of the area is 50 coyotes. In the same habitat, the bobcat population has 30 individuals, the potential reproductive rate per individual per year is 2, and the carrying capacity of the area is 100 bobcats. The bobcats depress population growth of coyotes through competition by 0.20, while the coyotes depress population growth of bobcats through competition by 1.1. What will the population size be for coyotes next year? *Note that this is the other half of the bobcat question, and you need to round your answer to a whole animal. 40 5 45 16 55Back at the original beaver population, only 40 beavers remained. This population also has a growth rate of 0.6 and generation time of 2 years. But the place on which this population resides is much smaller and has a carrying capacity of 200. How many beavers do you expect to find in the original population after 6 years?
- In 2017, 16 bison were released into Elk Island National Park. Within the next five years, 42 more bison will be released into the 1,200 km2 area. During the study period, it is expected that 45 calves will be born and 13 bison will die or be removed from the study area. What is the expected per capita growth rate of the bison population during this study period? Express your answer rounded to two decimal places. If the population is decreasing indicate this with a negative sign.Pronghorns look very similar to antelopes and are considered the fastest mammal in North America. They can be found in the Southeastern parts of Alberta. In the 1800s, it is thought that the population of pronghorns reach 35 million in the Prairies. By 1924, only 20,000 pronghorns could be found in Alberta. In 1996, only 9,600 remained. What is the per capita growth rate of pronghorns in Alberta between 1924 and 1996? Express your answer as a value between 0 and 1 rounded to two decimal places. If the population is decreasing indicate this with a negative sign. AnswerThis growth trend depicted on the graph is called_, which means the population grows without limits. Potential Deer Population Growth in 10 Years based on initial growth rate at George Reserve Deer Herd 1000 900 800 700 600 500 400 300 200 100 1 2 4 5 6 7 10 Years a) logistic population growth b) exponential population growth c) sinusoidal population growth d) cannot be determined from graph. Population Size
- Back at the original iguana population, only 40 iguanas remained. This population also has a growth rate of 0.6 and generation time of 2 years. But the island on which this population resides is much smaller and has a carrying capacity of 200. How many iguanas do you expect to find in the original population after 6 years?In a forest in India, there are 800 axis deer and 500 barking deer. The forest can support a maximum of 1,200 barking deer. The competition coefficient of barking deer on the axis deer is 0.25, and the competition coefficient of the reverse pair is 0.5. The intrinsic growth rate of barking deer is 2.0. Based on the Lotka-Volterra model, the population growth rate for barking deer is 416.67 Now, let's see if the two species can coexist in this forest. You are provided with some additional information: the carrying capacity of axis deer is 4,000. Determine if the two species can coexist.A population of Emperor Penguins has 140 individuals in 2015, when they are counted again in 2017 there are 320 individuals. What is the per capita growth rate of this population? 90/140 180/2 320/2
- In 1975, the population of Peary caribou among the Arctic islands was around 28 000. In 1976, there were 1600 deaths and 900 births, and no immigration or emigration. Calculate the population change as a percentage. Show your work.You want to estimate the population size of pink salmon in the upper pitt river and use a mark-recapture technique to do so. You mark 1313 individuals as they pass under the port mann bridge. two weeks later you recapture 2245 individuals in pitt lake of which 204 have marks on them. What is your estimate of the population size?Trumpeter swans were once widespread and abundant in North America. However, a combination of heavy hunting pressure and habitat lost drastically 4 reduced the species’ population down to less than 70 individuals in the wild by the mid-1930s. By the mid-1980s, Trumpeter swans were more prevalent again in Alberta, especially near Grande Prairie. The following graph depicts the estimated number of Trumpeter swans in Alberta, carried out at five-year intervals from 1985 to 2010. What growth pattern of the Trumpeter swan population in Alberta is being observed? What environmental conditions allow the growth pattern that you identified? What may cause the growth pattern that is being observed to change?