Once you have idenified a gene that you suspect is responsible for the disease, you clone the gene in a vector and grow it in the lab (outside the alligator). Which assay would allow you to modify the DNA of the gene in order to figure out what the gene does? O Northern Blot Southern Blot site specific mutageneis O pull down assay / CHIP assay O Differential Display Expression Vector Assay O SAGE O Gene Gun

Once you have idenified a gene that you suspect is responsible for the disease, you clone the gene in a vector and grow it in the lab (outside the alligator). Which assay would allow you to modify the DNA of the gene in order to figure out what the gene does? O Northern Blot Southern Blot site specific mutageneis O pull down assay / CHIP assay O Differential Display Expression Vector Assay O SAGE O Gene Gun

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Which one of the following statements is FALSE regarding the Ames test? O liver enzymes are added to the assay so that it will mutate the DNA of the Salmonella bacteria O Agar plates that do not include histidine are used to examine whether the test substance has caused mutations O A control is necessary to determine the background level of mutation The suspected mutagen (test substance) is omitted from the negative control sample O The test is done to determine whether a particular chemical can cause a reversion of the mutant strain to the wild type phenotype
Sal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR
i have a gene (3222bp) i want to put it into a expression vector (pet 28b+),when i did pcr i flanked my insert with EcoRI and HindIII restriction sites,how do i ensure that i insert the gene in the correct orientation in the vector,so that translation of the gene into a protein occurs.if the gene is inserted in the wrong direction would that mean i cant translate or would it just give me the wrong protein produced. also is the vector the one providing the start and stop codon ,and if so how do insert my gene so that it has a start and stop condon in the right fram
Explain your experimental approach if you must correct the genetic defect phenylketonuria, which is caused by mutations in the phenylalanine hydroxylase gene using the CRISPR/Cas9 system and homology directed DNA repair.
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.
5' UTR 5' and 3' UTR This region is specific sequence surrounding the start codon. OK Os OT OP LEU2 KSTP 2μm plasmid DNA Gene of interest 2μm plasmid DNA GAPDI GAPDP SC Cu/Zn-SOD cDNA Amp oriE gene What is selectable gene in this vector? 3' UTR
Sal1 Xho1 Insert pUC cloning vector + MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGÁC RE cut site LacZ alpha AmpR
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
RNA sequencing can detect DNA mutations typically easier to analyze can detect transcripts with very low abundance Both Answer Bank used for gene-expression analysis Microarray requires transcript-specific probes
O e. Gene amplification CLEAR MY CHOICE To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? Oa. Western blotting O b. Gene knockdown O. PCR/OLA O d. Microscopy O e. DNA hybridization Paternity testing can be detected most precisely by using technique
What is the role of the following molecules in the CRISPR mechanism? * Sequence of 3 nucleotide Not a RNA significant sequence Endonuclease motif that is Host genetic synthesized role in information to match a a binding CRISPR target site mechanism sequence Cas9 guide RNA DNA polymerase PAM Cellular DNA TRNA O O 口ロ口ロロ