One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Q: What are the bonds that hold the backbone of each DNA strand together called?
A: A DNA strand is made up of multiple nucleotides.
Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…
A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: what is the adenine content
A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…
Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.
A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO…
A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…
Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if…
A: A DNA nucleotide is composed of five-carbon sugar called deoxyribose, a phosphate group, and one of…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?
A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: What is the complementary strand of the following DNA strand?
A: The type of nucleic acid present in the nucleus of the cell is deoxyribonucleic acid or DNA. It is…
Q: The two strands of DNA in a double helix are ______________.
A: The DNA is the genetic material of most of the organisms. It is a a polymer of nucleotides that…
Q: What would be the most obvious characteristic of the base distribution of a single-stranded DNA…
A: DNA of a virus has a genome made of deoxyribonucleic acid (DNA) that is replicated by a DNA…
Q: If a double-stranded DNA molecule is 15% thymine, what are the percentages of all the other bases?
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: If one side of DNA molecule had a base sequence of…
A: DNA or deoxyribonucleic acid, the major genetic material, is a polynucleotide chain made of…
Q: If an RNA strand generates its complementary strand, thus producing a double helix, will a molecule…
A: Nucleic acids are the main information carrying molecules of the cell and by directing the synthesis…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing…
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic codes for an…
Q: If a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in…
A: According to Chargaff's rule, A = T and G = C, as adenine (A) binds with thymine (T) and guanine (G)…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Create the complementary strand for the DNA strand. ATTTGGTT
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…
A: DNA replication is the process of formation of DNA without using its own template . This process…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: If one strand of a DNA molecule has the base sequence 5′-AGCATTAAGCT-3′, what is the base sequence…
A: The complementary base pairing rule or Chargaff’s rule states that the DNA base pairs are always…
Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…
A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20
Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…
A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…
A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…
Q: Name the bases in the pentanucleotide with the sequence G-A-U-C-A. Does this come from RNA or DNA?…
A: The nucleic acids Deoxyribose sugar (DNA) and Ribose sugar (RNA) are nucleotides that are made up of…
Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: What type of DNA helix spirals to the left and the backbone takes on a zigzag shape?
A: Deoxyribonucleic acid (DNA) is the genetic material of the majority of the organisms.
Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…
A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…
Q: Type the matching bases in each DNA sequence. G A T A G C T A G G
A:
Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…
A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…
Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…
A:
Q: What is known synthesized DNA is called the leading strand?
A: The hereditary ingredient in the cell is the genetic material. DNA is present in the nucleus of…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?
A: DNA stands for Deoxyribonucleic acid. It acts as the genetic material in all living organisms. It is…
Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…
A: DNA is the genetic material that involves the transfer of information from one generation to the…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: DNA is composed of nucleotides which form its building blocks. Each nucleotide comprises a…
Q: If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A: A nucleotide is a bio molecule that consist of a nitrogenous base, a pentose sugar (deoxyribose in…
Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…
A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…
Q: The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
- Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the base sequence of the complementary strand. What special type of sequence is contained in thisDNA segment? Does the double-stranded DNA have the potential to form any alternative structures?If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
- Permutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________