P generation Wild grass (Aegilops speltoides or related species) Einkorn wheat (Triticum uratu) Genome BB Genome AA (2n - 14) (2n - 14) Gametes F, generation Hybrid Genome AB (2n - 14) Mitotic nondisjunction Emmer wheat (Triticum turgidum) Wild grass (Aegilops tauschil Genome AA BB Genome DD (4n- 28) (2n - 14) F2 generation Hybrid Genome A BD (3n - 21) Mitotic nondisjunction Bread wheat (Triticum aestivum) Genome AA BB DD (6n - 42)

P generation Wild grass (Aegilops speltoides or related species) Einkorn wheat (Triticum uratu) Genome BB Genome AA (2n - 14) (2n - 14) Gametes F, generation Hybrid Genome AB (2n - 14) Mitotic nondisjunction Emmer wheat (Triticum turgidum) Wild grass (Aegilops tauschil Genome AA BB Genome DD (4n- 28) (2n - 14) F2 generation Hybrid Genome A BD (3n - 21) Mitotic nondisjunction Bread wheat (Triticum aestivum) Genome AA BB DD (6n - 42)

Name: What would be the chromosome number of progeny resulting from the foll
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: What would be the chromosome number of progeny resulting from the following crosses in wheat (see Figure )? What type of polyploid (allotriploid, allotetraploid, etc.) would result from each cross?Q. Einkorn wheat and bread wheat P generationWild gra

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Consider the arrangement of the following four normal chromosomes from some hypothetical organism where, denotes the location of the centromere: A BCDEF GHIJ KLMNO For the following question indicate what type of chromosomal mutation has occurred. GHIJ KNMLO O a. Robertsonian translocation O b. Reciprocal translocation O c. Pericentric inversion PQ RSTU V WXYZ O d. Segmental duplication Oe. Paracentric inversion
An inversion heterozygote has the following inverted chromosome: Centromere ca a a A B CD JI HGF E, KL M Inverted region If a crossover occurred between genes H and I on one inverted and one normal chromosome, what would be the sequence of the dicentric chromosome before completion of metaphase I? A Cen B C D EFGHIJKL Cen M A Cen B C D JIHGFEKLM Cen JIH G F E Cen A Cen B C D JIHGFEDC B Cen A MLKEFGHIJKLM
The plant Haplopappus gracilis has a 2n of 4. A diploid cellculture was established and, at premitotic S phase, aradioactive nucleotide was added and was incorporatedinto newly synthesized DNA. The cells were then removed from the radioactivity, washed, and allowed to proceed through mitosis. Radioactive chromosomes or chromatids can be detected by placing photographic emulsionon the cells; radioactive chromosomes or chromatids appeared covered with spots of silver from the emulsion.(The chromosomes “take their own photograph.”) Drawthe chromosomes at prophase and telophase of the firstand second mitotic divisions after the radioactive treatment. If they are radioactive, show it in your diagram. Ifthere are several possibilities, show them, too.
Shown below are eight DNA sequences from different individuals QHow many different haplotypes (sets of linked variants) are found in these eight sequences
The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
Drosophila researchers have collected many strainsthat carry a single recombinant P element containing awild-type white gene (a P[w+] transgene) inserted intoa known genomic location. These strains can be used tomap the location of any mutant gene in the fly genome.Investigators performed a testcross to map arecessive mutation rough (ro), which causes rougheyes, relative to a P[w+] element on chromosome 3.Females heterozygous for the P[w+] on one chromosome 3 and a ro− mutation on the other, homologouschromosome 3 were crossed to ro−/ro− males, and theprogeny in the following list were obtained. In boththe parents and the progeny, the endogenous whitegene is nonfunctional—the flies have red eyes onlyif they contain the P[w+] transgene.145 red, smooth (wild-type) eyes152 white, rough eyes2 white, smooth eyes1 red, rough eyesa. Are ro and the P[w+] linked? If so, how many mapunits separate them?b. The data in part (a) do not indicate on which sideof the P[w+] (toward the centromere or…
ABCDE FGH MNOCDE FG MNOPQR АВРО R Vhat type of chromosomal mutation is seen in the corresponding picture? elect one: D a. Duplication O b. Inversion O c. Reciprocal translocation O d. Non-reciprocal translocation e: Deletion stulate was NOT based on the
. A diploid strain of yeast was made by mating a haploidstrain with a genotype w−, x−, y−, and z− with a haploidstrain of opposite mating type that is wild type for thesefour genes. The diploid strain was phenotypically wildtype. Four different X-ray-induced diploid mutantswith the following phenotypes were produced fromthis diploid yeast strain. Assume a single new mutation is present in each strain.Strain 1 w− x+ y− z+Strain 2 w+ x− y− z−Strain 3 w− x+ y− z−Strain 4 w− x+ y+ z+When these mutant diploid strains of yeast go throughmeiosis, each ascus is found to contain only two viablehaploid spores.a. What kind of mutations were induced by X-rays tomake the listed diploid strains?b. Why did two spores in each ascus die?c. Are any of the genes w, x, y, or z located on thesame chromosome?d. Give the order of the genes that are found on thesame chromosome
Consider the arrangement of the following four normal chromosomes from some hypothetical organism where, of the centromere: A BCDEF GHIJ KLMNO For the following question indicate what type of chromosomal mutation has occurred. V.WXYYZ O a. Robertsonian translocation O b. Paracentric inversion O c. Reciprocal translocation PQ RSTU V WXYZ O d. Segmental duplication. Oe. Pericentric inversion , denotes the location 1 points Save Answer
7.4 5577 20/ CV* 5. (a) Complete the following diagram to show the process by which gametes are formed. amand NOR NO devane 8 8. 072 404 PACLIGNO YOU Forsch chenyle VI SAMNING Zeytmos Lectopic of 12 mesecer in 200AU g Chor WERY IN 12120/ ZAINA Stage Act PE Stage B 2X P Stage C AUT2 Xyadden che d S www.w opov 02/01 88 8 us ml 151/3/0/00 COADCA CLAS Stage D Janis Stage E
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.