Pen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting thepopulation living along the Limpopo River Basin. Scientists working on the elucidation of more detailsabout the virus have finally characterized it as a DNA virus (containing DNA as a genetic materialand not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of theviral genome responsible for viral replication, is shown with the following sequence:DNAsequence:5'-CTACACTITATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3'A. "Transcribe" and form an RNA transcript based on the DNA sequence.B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of theresulting polypeptide using the genetic code.*Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and labelcorrectly the ends of the molecules mentioned.C. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNAsequence given?

The process of formation of messenger RNA with the help of the template srrand of DNA is called…

Pen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting the population living along the Limpopo River Basin. Scientists working on the elucidation of more details about the virus have finally characterized it as a DNA virus (containing DNA as a genetic material and not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of the viral genome responsible for viral replication, is shown with the following sequence: DNA sequence: 5'-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3' A. "Transcribe" and form an RNA transcript based on the DNA sequence. B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. C. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?

Pen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting the population living along the Limpopo River Basin. Scientists working on the elucidation of more details about the virus have finally characterized it as a DNA virus (containing DNA as a genetic material and not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of the viral genome responsible for viral replication, is shown with the following sequence: DNA sequence: 5'-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3' A. "Transcribe" and form an RNA transcript based on the DNA sequence. B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. C. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 4DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive supercoiling. The stress of this force must be overcome or the replication machinery will be unable to proceed. DNA gyrase, a bacterial __________, is the leading candidate for this role in coli.
Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
Replication of many RNA viruses depends on RNA polymerase. The antiviral drug ribavirin does not inhibit the polymerase but instead increases its error rate. Explain how this affects the virus.
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?
. Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’ direction.
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.
Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.