Please help me with questions 1 & 2 1. In photosynthesis, the carbon in CO2 is ______ to form glucose. A. Energized B. Reduced C. Broken down D. Oxidized E. Respired 2. The genome of an organism is all of its. A. Proteins B. Genetic material C. RNA D. All answers are correct E. Characteristics
Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…
A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…
Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…
A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…
Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…
A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…
Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…
A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…
Q: Give a specific example on how to use UV-Vis spectrophotometer in Cosmetic Science. Provide a…
A: The UV/Vis spectrophotometer is thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer.…
Q: Describe the enzymatic reaction of the protein epidermal growth factor. Include the specific…
A: Epidermal growth factor is a protein, involved in cell cell proliferation and differentiation, by…
Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).
A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…
Q: What is the role of lactic acid? It is converted to pyruvic acid through glycolysis. It is a…
A: Introduction Lactic acid is an integral part of the human body, it is is a chemical byproduct of…
Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…
A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…
Q: With the aid of diagrams, and using specific examples, describe how gene expression is regulated in…
A: Transcription Is the process of formation of mRNA from DNA and this happens in the cytoplasm of the…
Q: of the following is not an example of green infrastructu Pavement Bioswales Bioretention Planter…
A: Lack of greenery has made the life difficult. In order to promote greenery and conserve water, green…
Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…
A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…
Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…
A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…
Q: what is the expected number of individuals of Aa bb Cc genotype if 1000 progeny result from this…
A:
Q: 7. Your tire blew out on the way coming to this exam. What would your hypothesis for the cause of…
A: A hypothesis is built to determine the effect of a change on a particular occurrence. Hence, in this…
Q: Which of the following human cells contains a gene that specifies eye color? Gametes (sperm and egg)…
A: Introduction The fundamental unit of heredity is the gene. DNA, or deoxyribonucleic acid, makes up…
Q: 8. What Is the plcture below illustrating? plart Easier bluebird red-aled huwk 9. Interconnected…
A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…
Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…
A:
Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…
A: INTRODUCTION Answers to question 1-10 is given below.
Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…
A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…
Q: Answer the following questions about this phylogenetic tree. What animal represents the out group in…
A: According to bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: ´A D. E В Coronal Suture [ Choose ] Supraorbital Torus [ Choose ] Mastoid Process [ Choose ] Mental…
A: In vertebrates, the cranium is a bony structure that creates the head. It creates a safe chamber for…
Q: ic Variation and Evolution Mastery Quiz ay 2 at 2:40pm Instructions Question 1 1 pts In Mendel's…
A: In monohybrid cross of Mendel's experiments : Dominant = TT Heterozygote = Tt Recessive = tt
Q: Sex linked 6. traits are those found on the chromosomes determining gender, and show up more often…
A: Multiple allele is a condition and according to that, In a gene there are more than two alternate…
Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…
A: Induction is the process by which the presence of one tissue influences the development of others.…
Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…
A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…
Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…
A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…
Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…
A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…
Q: Define toxicology dose and response
A: Toxicology Dose response curve is defined as the response of target host to various doses of toxic…
Q: In the DNA of any individual human, about 300 mutations may differentiate the genome from either…
A: Introduction Gene:- A gene is the basic physical and functional unit of heredity. It is a part of…
Q: What are the two important parts of Meromyosin protein?
A: Introduction - Myosin contains a component called meromyosin (mero meaning "part of"). Myosin and…
Q: You have cloned the protein coding region of the porin gene from a phage into a bacterial cell for a…
A: Generally the phage viruses don't have a transcription or replication machinery they are dependent…
Q: Question 14 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A:
Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…
A: The electron transport chain is located in the mitochondria in eukaryotes and in the plasma membrane…
Q: How does we know that trees or plants are transpiring base on your experiment?
A: The physiological process by which water is lost in the form of vapour from the living tissues of…
Q: Compare and contrast the immune system/immune response between plants and animals using a Venn…
A:
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles Ostriches Feathers…
A: In biology, evolution refers to the change in a species' features over numerous generations as a…
Q: 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently…
A: As already mentioned in the question pernicious anemia is a disease which occurs due to inability of…
Q: 2. Calculate the following: a. you are asked to prepare 10 NA slants and 5 NA stab in big tubes. How…
A: Growth media also known as culture media are used to cultivate microorganisms. These media are a…
Q: what are evidences that indivate plants are measuring the length of the night?
A: Introduction The physiological response of organisms to the length of night or a dark period is…
Q: Most inherited forms of cancer involve _______________ and these individuals are for the mutation.…
A: Firstly we can examine what each of the terms given represents. 1. Tumor suppressor gene: It is a…
Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…
A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…
Q: intensity €495 1295 567.5 567.9 1995 s
A: M/z means mass to charge ratio . The first step is involves selecting largest leaks in mass spectrum…
Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…
A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…
Q: Illustrate polymerase chain reaction through a detailed process map
A: Since then, PCR has played a critical role in a wide range of biological and medicinal studies.…
Q: A heart microslide demonstrates cells in the shape of pale chords, which have few myofibrilla,…
A: 2. ANSWER;- Contractile cells, Purkinje's fibers Explain;- Contractile cells conduct impulses and…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: DNA is the store house of genetic information. This information is transferred to mRNA through the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- siness mg re b. cellular respiration ostra uct rgr 63. A student is collecting the gas given off from a plant in bright sunlight at a temperature of 27 degrees Celsius. Which gas would the student be collecting? a. охудеn b. carbon dioxide C. ATP 64. Plants and animals exchange materials through the processes of photosynthesis and respiration. Whieh of the d. vaporized water e. nitrogen uo obout tho wy these bwo nrocesses are related?ks ר SESSIONS Moving to another question will save this response. Question 1 Which of the following observations about mitochondria is false? O A. Mitochondria have their own ribosomes and make some of their own proteins. O B. Mitochondria are surrounded by two membranes. O C. Mitochondria have a single, circular chromosome. O D. Mitochondria are about the same size as an average bacterium. O E. Mitochondria replicate by mitosis. Moving to another question will save this response. to searchMULTIPLE CHOICE: Choose and encircle the letter of the best answer from the given choices. 1. All producers and consumers use the chemical process of respiration to synthesize C. alcohol Which of the following is NOT a part of the mitochondria? C. Cistae a. C¢H12O6 b. ATP d, oxygen 2. Ostroma b. outer membrane The structure found between the outer membrane and inner membrane is callec b. intermembrane space a. Matrix 3. ...... a. Cristae C. thylakoid d. granum 4. The inner folding of the mitochondria is called Cristae a: D. granum C. thylakoid d. matrix 5. Which of the following does NOT produce ATP? Lactic acid fermentation C. Krebs cycle d. glycolysis a. b. Oxidative phosphorylation
- 60.A mobile, lipid soluble carrier of TWO electrons present in chloroplasts is ___. Select one: a. cytochrome c b. Q c. plastocyanin d. PQBCystic Fibrosis APPLY WHAT YOU HAVE LEARNED You are a researcher working on a treatment for Hutchinson Gilford progeria syndrome, an extrernely rare genetic disorder that causes accelerated aging in children. Children with progeria generally appear healthy at birth but soon start growing more slowly than other children and lose their hair. Additional symptoms include stiffness of joints, heart problems, and stroke. These children typically die of heart disease at an average age of 13 years. 5. Progeria is caused by a mutation in a single gene, called lamin A. Scientists have identified over 1,400 mutations in the lamin A gene that result in changes in transcription, RNA splicing, and/or protein production. Lamin A codes fora protein required for the structural support of the nuclear envelope in cells. Without a functional protein, the nuclear envelope becomes unstable, eventually damaging the nucleus and causing cells to die, Based on what you learned in this Click & Learn, propose a…FA MAT- SP BIO-2 SP BIO-2 tal Learnin Match the part of a cell from the left column to the best description on the right. Golgi Apparatus A. all eukaryotic cells have one of these B. site of photosynthesis C. gives cells shape and involved in cell movement D. site of cellular respiration Chloroplast Rough Endoplasmic Reticulum (ER) Mitochondria Nucleus Plasma Membrane _Cytoskeleton Cell Wall E. made of phospholipids and surrounds cell F. synthesizes new proteins G. outside of plasma membrane H. involved in exocytosis
- Part A: Animal cells do not have chloroplasts A. True B, False Animal cells carry out cellular respiration as long as they are alive. A. Yes B. No Part B: Bacteria carry out cellular respiration A. True B. False Photorespiration is same as cellular respiration NO YesCreate a profession... Thoroughly proofre.... uestion Completion Status: O a. Carbon dioxide (CO2) O b. alcohol O c. lactic acid O d. All the above QUESTION 3 Be your wattpad gh.... QUESTION 4 The lab instructor will have a photosynthesis demonstration set up for your observation. What product are we observing? O a. glucose O b. alcohol O c. Carbon dioxide (CO2) O d. Oxygen (O2) Write your original... EKU Corbin BIO100 Capstone Sun Shiel.... Squier Bullet Strato When oxygen is present (aerobic cellular respiration), the cell goes through all the following steps EXCEPT Click Save and Submit to save and submit. Click Save All Answers to save all answers. 5 M 8 0 Ama(AKS 4b / DOK 1) Which process is best represented by the following chemical equation? glucose + oxygen ----> carbon dioxide + ATP O A. Photosynthesis O B. Fermentation O C. Cellular respiration O D. Light Reaction 5 Type here to search fg f1o f2 ? #3 & * 3 24 4 6. W E R. Y %24
- Question 5. Which of thefollowing are never found inbacteria?A. RibosomesB. Internal membranesC. Cytoskeletal proteinsD. DNAE. Mitochondria14 Select the correct answer. The function of mitochondria and chloroplasts is related to energy. In what way does their function differ? O A. Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells. O B. Mitochondria produce energy from food, while chloroplasts produce food from the Sun's energy. O C. In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green. D. Mitochondria provide energy in the night, while chloroplasts provide energy in the day. E. Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun's energy. Reset NextQuestions: CELLULAR ORGANELLES. Match the description (A-J) with the cell organelle by placing the letter in the appropriate space. Each letter will be used only one time. ____ endoplasmic reticulum A. gives stiff shape to plant cells ____ chloroplasts B. factory where proteins are built ____ Golgi bodies C. packaging and shipping center for proteins ____ DNA D. power plant of the cell ____ cytoskeleton E. phospholipid bilayer found in all cells ____ plasma membrane F. large storage sac in plant cells ____ cell wall G. involved in cell shape and movement ____ mitochondria H. carries genes ____ vacuole I. virtual highway for proteins ____ ribosomes J. plant organelles that perform photosynthesis