Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?*NH2`NH*HOно.N"NH2*онÓHDA The positions indicated by the arrows.O B. The positions indicated by the asteriks.OC All of the positions can form Watson-Crick base pairing.None of the positions can form alternate base pairing.OD.*O

Hydrogen bond is a noncovalent bond forms between hydrogen and oxygen or nitrogen or other more…

positions in tne purine ring of a purine n nydrogen bonds but are not involved in deotide nave the potential base pairing? * NH2 `NH* HO HO. 'NH2* он OH OH The positions indicated by the arrows. OB. The positions indicated by the asteriks. OG All of the positions can form Watson-Crick base pairing. D. None of the positions can form alternate base pairing. *O:

positions in tne purine ring of a purine n nydrogen bonds but are not involved in deotide nave the potential base pairing? * NH2 `NH* HO HO. 'NH2* он OH OH The positions indicated by the arrows. OB. The positions indicated by the asteriks. OG All of the positions can form Watson-Crick base pairing. D. None of the positions can form alternate base pairing. *O:

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 16QP: A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA...

See similar textbooks

Similar questions

A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
HN N C N H₂N HN پرسپولیو D B CH₂ -N N NH₂ E When part of a nucleotide in a nucleic acid chain, which of the following may base pair with thymine nucleotides? Choose all correct answers and assume normal Watson-Crick base pairing.
Choose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.
A C Bo B D Out of the 4 base pairs that are shown, B and C are the ONLY Watson-Crick base pairs that are found in BOTH DNA and RNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs. The base pair shown in D is almost never found in the DNA double helix. because the extra space occupied by the two purine bases would severely distort the helical structure normally generated by base pairs involving a pyrimidine base and a purine base. The base pair formed in A is less stable than the Watson-Crick base pair shown in B partly because of a smaller number of hydrogen bonds and partly because of less favourable pi-stacking interactions with adjacent base pairs.
Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the positions in the purine ring of a purine nucleotide in DNA that have the potential to form H. hydrogen bonds but do not participate in Watson–Crick 6 base pairing. N С-6 N-1 8 CH C-5 12 HC 4 9 С-2 N. H С-8 Purine N-7 N-9 N-3 O C-4 O O
The top side of this figure offers more opportunities (for each base pair) that can lead to highly specific protein-DNA interactions. True or False? Major groove Major groove (a) Major groove Major groove O True N-HI110 O False A NIIH-N Minor groove Adenine-Thymine CH3 0111H-N H₂C OFITH 98 TN- GN-HIIN V-HillO Minor groove Guanine Cytosine Minor groove Thymine-Adenine Hillo C NIH OIH -NG Minor groove Cytosine Guanine
A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a B-form helix, with about 10.5 base pairsper turn. The DNA circle has 12 superhelical turns. What is its superhelixdensity s?
The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
Describe the theoretical structure for deoxyribonucleic acid. Specifically, describe the attributes (features) of the Watson and Crick model for DNA. I cant figure out where to begin this for my homework.
What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha hetero