program Credit Card Validator - Takes in a credit card number from a common credit card vendor (Visa, MasterCard, American Express, Discover) and validates it to make sure that it is a valid number (look into how credit cards use a checksum). -this is C++ program so use #include . Also Please Use pointers, Arrays, and input/output files in the program
Q: Debug the following code in C++. This file is used to print integers from highest to lowest,…
A: The debugged code is provided in next step:
Q: Lab 9-6: Pass by Reference and Pass by In this lab, you complete a partially written C++ program…
A: Function calling: In the pass-by-value approach, the original value acts as the function parameter.…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: Some of the practices one should keep in mind while writing a program are: Utilize consistent…
Q: int power (int base, int exp); It accepts the arguments for base and exponent and returns power.…
A:
Q: Write a simple JavaScript program to calculate the average mark and to calculate the grade of a…
A: script.js // function for calculateAverageMarkfunction calculateAverageMark(...args) { // args is…
Q: In C++ Language (please use hint) : Write a function which will swap its arguments if the first…
A: Call by reference: In this approach, passing the arguments to a method copies the address or…
Q: Under what circumstances can you successfully return a pointer from a function?
A: circumstances can you successfully return a pointer from a function
Q: Write a C++ function named greater_10. This function returns an int and has two integer arguments,…
A: ⦁ In the function greater_10() two argument has been passed from main function where the user will…
Q: TRUE or FALSE - In C++, a function can't return a pointer. Select one: a.FALSE b.TRUE
A: Lets see the solution.
Q: C++ program for infix to postfix conversion. (Use OOP) Write proper comments. Please dont use…
A: #include<iostream> #include<stack> using namespace std; // defines the Boolean…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: the question is: Good Programming practices help in improving programs readabilityand…
Q: Q3. Write a C++ program to write two functions for multiplication and modulus. The two numbers must…
A: void multiplication(int a, int b){ cout<< "Multiplication result :…
Q: A particular talent competition has 5 judges, each of whom awards as score between 0 and 10 to each…
A: def getJudgeData(): var = -1 while 1: var = int(input()) if(var>=0 and…
Q: Using C++ Write the section of code which takes an array of characters and copies it to another…
A: The question is to write the code for the provided scenario.
Q: Write a public static void function named getLongestName
A: Step 1: Prompt and accept number of names, n. Step 2: Prompt and accept the names. Store it in the…
Q: Write a C++ program to find whether the student is eligible based on marks, attendance, or both.…
A: Note : Here I have taken the criteria as 80 and 100 both inclusive , you can change them as…
Q: CODE USING C++ When dealing with problems, it is always best to find the "elephant" in the room.…
A: We can call a 2D array by: function_name(array_name); Example: findElephant(matrix);
Q: Code in C please. write a user defined function called pasttense that takes one argument a character…
A: logic:- In user defined function, calculate length of passed parameter. then fetch out last two…
Q: Lab Assignment Question 1- Program in C++ to take input size of array from user and show how to…
A: In C++, cin function is used to take input a variable and syntax of declaration of array is: int…
Q: write in c++ please but not use stl, use array please... Use the following headers to create a…
A: Program Explanation: Initialize a constant type integer variable MAX of value 26 The function sort()…
Q: Assume pint is a pointer variable. For each of the following statements, determine whether the…
A: Note: There are multiple questions are given in one question. According to the rule, you will get…
Q: Code a guessing game in Python Parameters: The number guessing game allows the user to enter a…
A: Find a viable explanation in the code below.
Q: Code in C please. for this question you will write a function definition and a main function.…
A: In this C program , the main function makes a call to runmenu() function. runmenu() function will…
Q: What is the output of the code below? #include using namespace std; main(){ int array[) = (10, 20,…
A:
Q: C++ Program - Arrays- Chapter 7 Include the following header files in your program: string, iomanip,…
A: Given:
Q: 3- It is not possible to change the value of the pointer. (True or False). 4- If the following lines…
A: We need to answer questions related to C++ program. *As per the guidelines only 1st 3 question is…
Q: This is an computer programming question The code should be in C++ language Define an enumeration…
A: required: a program that prompts the user to input the length of the sides of a triangle and outputs…
Q: 2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the…
A: In the Given question First, you have to write pseudo code for the given problem and then you have…
Q: Strings are important data types in C++ and there are many built-in functions applied on strings.…
A: I take the input as character of array and uses both userdefined method or builtin function to…
Q: m with two user defined functions. The first function named “functionWithArray” takes two user input…
A: code : Here is my code for 5.1 : #include <iostream> #include <string.h> using namespace…
Q: Parallel Arrays Summary In this lab, you use what you have learned about parallel arrays to…
A: 1) Below is updated program that looks up and prints the names and prices of coffee orders or error…
Q: Lab Assignment Question 2-Program in C++ to take input size of array from user and then take input…
A: To find sum of all elements in the array, initialise a variable sum=0 and run a loop from i=0 to…
Q: Suppose you are a surveyor. Your job requires you to study some maps that give distances in…
A: The surveyor study the map. The map gives the distance in kilometers and miles. Write a program to…
Q: Pass Array to function. Write a C++ Program: Create two arrays of size 5 and then pass those…
A: Lets assume your id=15. step1: initializes both array. step2: print content o both arrays step3:…
Q: Define the function: int power (int base, int exp) {/*It accepts the arguments for base and exponent…
A: I give the code in C as per your requirement along with output and code screenshot
Q: c++ This program prompts the user to enter three distinct int type values and display the maximum,…
A: Code and screenshot is attached, tested with many test case and working fine. (note that Median…
Q: What does it mean to overload a function?
A: Function overloading (also technique overloading) could be a programming thought that permits…
Q: in c Problem Print Patterns Using Loops] Write down a program to initialize an integer array ‘a[…
A: Given: in c Problem Print Patterns Using Loops] Write down a program to initialize an integer…
Q: o call any function you must write its name and arguments arguments O index name O
A: To call any function you must write it's name and arguments Answer is option a name and arguments
Q: Write a C++ program to create a class template using an array. Perform operations like sorting,…
A: Solution:-- 1)The given question has required for the solution which is to be provided in the C++…
Q: Lab1: Conversion CS-116 The purpose of this lab is for you to familiar with your C++ development…
A: #include<iostream> #include<string> #include<iomanip> #include<ctime> using…
Q: Numbers that are the same as the direction of reading when they are read backwards and straight are…
A: C Code of to find number is palindrome or not is detailed in step 2 with sample output below.
Q: 1- Write a python function that prompts the user for a name, age, and hobby and prints these in the…
A: Python Code: #function that prompts the user for a name, age, and hobby and prints itdef…
Q: (Pointers + Dynamic 1D Arrays) c++ program please use only pointers and dynamic 1D array and…
A: Coded In C++. No recursion or vector is used.
Q: b) Good Programming practices help in improving programs readabilit and understandability both for a…
A: Programs: Programs are used to solve complex problems and to perform various tasks according to the…
Q: uestion 1: (C++ Programming) Why could the following code crash? void Func( int *X ) { if( X )…
A: Required: Why could the following code crash?
Q: Exercise 2: Write, compile and execute the program below. Explain why the function swap does not…
A: GIVEN: There are two variables that should be swapped using the function. EXPLANATION: If u…
Q: Create a menu function "menuFunction" that has to contain the following list 1) print the summantion…
A: Program code: //include the required packages #include<iostream> using namespace std;…
-this is C++ program so use #include <iostream>.
Also Please Use pointers, Arrays, and input/output files in the program
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- program Credit Card Validator - Takes in a credit card number from a common credit card vendor (Visa, MasterCard, American Express, Discover) and validates it to make sure that it is a valid number (look into how credit cards use a checksum) - it's a C++ program so use #include <iostream> - And please use an array, use files, and use pointers in this program. -Lab Assignment Question 2-Program in C++ to take input size of array from user and then take input values of array and store them in the array. Then print the sum of all elements in the array.pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Topic: Array covered in Chapter 7 Do not use any topic not covered in lecture. Write a C++ program to store and process an integer array. The program creates an array (numbers) of integers that can store up to 10 numbers. The program then asks the user to enter up to a maximum of 10 numbers, or enter 999 if there are less than 10 numbers. The program should store the numbers in the array. Then the program goes through the array to display all even (divisible by 2) numbers in the array that are entered by the user. Then the program goes through the array to display all odd (not divisible by 2) numbers in the array that are entered by the user. At the end, the program displays the total sum of all numbers that are entered by the user.C++ language Write a program using Switch statement to perform the following functionalities.1. Press a to call functionOne.2. Press b to call functionTwo.3. Press c to call functionThree.4. Exit as any other key pressed.(default)functionOne will return product of all integers entered by user in array of size 8.functionTwo will perform greatest value in array entered by user.funtionThree will calculate lowest value in an array entered by user.
- Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() } Method main( { func() } What will happen when the above snippet is executed?Student Registration System is an approach that enables colleges and universities to better supervise a growing number of enrollments. Create a menu system for registration program in c++ that asking an input based on the choices below. If the input is A then the program will ask for name and program (course) store in two arrays, if B then the program will display all the data stored on the array and the program will be terminated only if the input is E. Apply also function on the program: Menu System – 1st Way of Function Add Student – 4th Way of Function Example: REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: A Name: John Lloyd Program: CpE REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: B Name Program…Student Registration System is an approach that enables colleges and universities to better supervise a growing number of enrollments. Create a menu system for registration program in c++ that asking an input based on the choices below. If the input is A then the program will ask for name and program (course) store in two arrays, if B then the program will display all the data stored on the array and the program will be terminated only if the input is E. Apply also function on the program: Menu System – 1st Way of Function Add Student – 4th Way of Function Example: REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: A Name: Sebastian Program: CE REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: B Name Program Carlo - CE Sevi - CE
- Task related to pointers : Write a c++ program that asks the user to enter integers as inputs to be stored in the variables 'a' and 'b' respectively. There are also two integer pointers named ptrA and ptrB. Assign the values of 'a' and 'b' to ptrA and ptrB respectively, and display them. ( Drop code in words , explain the code and drop the screenshot of output as well )Lab Assignment Question 1- Program in C++ to take input size of array from user and show how to declare an integer array of entered size.Variables can be passed to a function by Select one: a.reference b.all (pointer, value, and reference) c.value d.pointer