Protein structure.Circle one of the three amino acid sequences that is most likely to form a stable a-helix? RASKTARQ DASKTAEQ KPGKPAGQ In one sentence (that can be accompanied by a small picture) explain why?
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination can be described as the reaction of removal of α-amino nitrogen of amino acids by a…
Q: ATP constitutes the most common cellular energy currency. Explain the factors that account for the…
A: The human body comprises a trillions number of cells. Every cell comprises mitochondria. The main…
Q: The striatum is a structure within the basal ganglia. The striatum is comprised mostly of medium…
A: The striatum, consisting of the ventrally located nucleus accumbens (NAc) and dorsal caudate putamen…
Q: What components of the plasma membrane might this drug interact with? Explain can use as many…
A: The given compound is Lovastatin, a statin which is used as a drug to lower blood cholesterol in…
Q: Why do people with dark skin at risk to have VitaminD deficiency?
A: Dark skin people have more melanin production in their skin.
Q: • Outline the biosynthesis of tuberculostearic acid using phospholipid-bounded oleic acid and SAM as…
A: Tuberculostearic acid is a fatty acid found in the cell wall of Mycobacterium. The fatty acid was…
Q: 1 Specify the role each of the following amino acids play within the crystal structure and/or active…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: Relatively hydrophobic proteins will require higher amounts of (NH4)2SO4 to precipitate.
A: Amminium sulfate precipitation is a method of protein purification by altering solubility of…
Q: 15. Transamination reactions involve the conversion of a-ketoglutarate to (or from) which of the…
A: Transamination reactions involve the transfer of the amino group of an amino acid to an α-keto acid…
Q: The basement membrane of the filtration membrane electrically repels many positively charged…
A: The glomerular basement membrane (GBM) is a specialized structure with a significant role in…
Q: 1. You wish to develop a fluorescent sensor to monitor glucose concentrations in human serum.…
A: Fluorescent sensors are very useful and are used to study chlorophyll. It is also used for measuring…
Q: QUESTION 4 Look at the pedigree below. Which mode(s) of inheritance could explain this? Select all…
A: The pattern of inheritance is studied necessarily so as to study the pattern of disease transfer and…
Q: The enzymes responsible for forming the final phosphoiester bond between two DNA fragments during…
A: The phosphodiester bonds constitute the backbone of the strands of DNA.
Q: Which statement is true regarding denaturation process? Question 21 options: Protein…
A: Introduction: Proteins are synthesized on ribosomes as linear polypeptides. As they are synthesized…
Q: 26. AN ORGANIC COFACTOR IN A CONJUGATED ENZYME? A. NEITHER VITAMINS NOR MINERALS B. MINERALS C.…
A: Hi. Thank you for the question, as per the honor code, we are allowed to answer three sub-parts at a…
Q: Indicate whether each of the following conditions would increase or decrease the rate of…
A: Every day, about 180 grams of glucose are ingested. The brain uses 75% of the glucose intake, and…
Q: Look at this diagram of fally acid metabolism and malch the nutmbers wilh the enzymes, inlermediatos…
A: The Metabolism depicted is a fatty acid beta oxidation in which fatty acids are degraded into simple…
Q: Snake venom contains many hydrolase enzymes, including several serine proteases. One such protease…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 4. You are to choose the members of an expedition that will climb several high mour Each applicant…
A: Hemoglobin abnormalities are referred to as the type of blood disorders that have a major impact on…
Q: A polypeptide contains 36 amino acids. How many nucleotides should be found in the open reading…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: A biochemist is designing a new drug that will mimic the shape and function of a particular…
A: Endocrine disrupting chemicals can mimic hormones in our bodies and interfere with our physiological…
Q: Describe and compare the metabolism of carbohydrates, lipids and proteins and in your answer,…
A: We will answer the first question since the exact one was not specified. Please submit a new…
Q: Which carbons of Glucose 1-Phosphate will be incorporated into Lauric acid (C-12) by the Fatty Acid…
A: Correct option is option G: All carbons will be incorporated. Glucose (6C) in the form of…
Q: The molecule shown is an effective inhibitor of the enzyme hydrolase, explain how this likley…
A: Enzyme hydrolase are group of enzymes which breaks the covalent bond in a molecule using water…
Q: In this step of purine biosynthesis, which functional group gets activated by ATP Pribose NH3 ATP…
A: All organisms can make the purine and pyrimidine nucleotides by the de novo biosynthetic pathways.…
Q: Briefly explain why transition state analogs make excellent inhibitors
A: By blocking the active site of the enzyme, transition state analogues can be used as inhibitors in…
Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…
A: pentose phosphate pathway is a metabolic pathway of hexose oxidation where glucose-6-phosphate is…
Q: write true if the statement is correct, otherwise, change the underlined word/phrase to make it…
A: Electrophoresis is an analytical technique which is used to separate a mixture of biomolecules such…
Q: In an experiment of egg white and calamansi juice in protein denaturation, what will happen?
A: Proteins are one of the most important metabolites in living organisms, which is almost present in…
Q: A diazotrophic bacterium has a mutant glutamine synthetase with decreased activity. The mutant is…
A: Diazotrophs are PGPB (promote plant growth) and capeble of fixing atmospheric nitrogen gas into…
Q: Briefly discuss 2 advantages and 2 disadvantages of using the paraffin embedding method for…
A: Histocytological techniques are useful to examinations of tissues and are generally useful to fix…
Q: What is the standard free energy (AGº) for the reduction of coenzyme Q by NADH as carried out by…
A: Coenzyme Q (CoQ, ubiquinone) is produced across all domains of life and functions in electron…
Q: The first global mass bleaching of corals occurred in
A: A coral reef is a submerged ecosystem characterised by corals that build reefs. Reefs are made up of…
Q: 11. ADULTS WHO CANNOT TOLERATE MILK OR MILK PRODUCTS LACK THE ENZYME? A. LACTASE B. ENTEROKINASE C.…
A: Since you have posted multiple questions we will solve the first question for you. If you want any…
Q: Explain the steps of the BIOSYNTHESIS OF PHOSPHOLIPIDS with a diagram.
A: The phospholipids are the amphipathic molecules with the following components: fatty acids, alcohol…
Q: Which of the following statements about innate lymphoid cells is true? (ONE ANSWER) Require the…
A: Innate lymphoid cells (ILCs) are immune cells that lack a specific antigen receptor but can produce…
Q: E A C F В H O2 G Fumarate
A: The electron transport chain is a process in which the NADH and [FADH2] that is produced during…
Q: Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose…
A: Enzyme are proteins or catalyst that help to speed up metabolism or chemical reaction in our body…
Q: Heating an enzyme makes it no longer function correctly because the heat: O A) removes phosphate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: IID. SAPONIFICATION The figure below summarizes the results for saponification test. Provide the…
A: Saponification is the formation of a sodium salt of a fatty acid and such a salt is called a soap.…
Q: They say niacin is not a true vitamin, why?
A: Niacin : It is a form of vitamin B3 made in the body from tryptophan.
Q: Explain the cell membrane’s lipid bilayer. What are the lipids found in the cell membrane?…
A: The lipid bilayer present in the membrane consists of the polar head group consisting of the…
Q: 7. Which of the following is true of water in the hydration layer of proteins? a. It has a lower AS…
A: Note : Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: 1. (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a single origin and a…
A: DNA replication is the process of producing two identical copies of DNA from one double stranded DNA…
Q: Which of the following shorthand names best characterizes the following disaccharide? a. Glc…
A: Carbohydrates are macronutrients and significant nutritional components. They can be formed as…
Q: Löök at the diagram of a DNA molecule. Which of the letters W, X,Y and Z correspond to the following…
A: Deoxyribonucleic acid (DNA) is the molecule that conveys genetic information for growth and…
Q: A protein molecule is approximately spherical and has a hydrodynamic diameter of 35μm. What is the…
A: The protein interaction is classified as one of the most important and fundamental steps in the…
Q: CH2O에 off C1420H 3, 애 4 04 OH 4 of
A: The difference between alpha (α) and beta (β) glucose is the orientation of hydroxyl (-OH) group…
Q: You have been provided with the results of a sequence analysis of the gene for a fish with a small…
A: Chromatograms are depicted in colourful peaks which are used to represent the sequence of bases in…
Q: (1) List and briefly explain four methods of studying an E-S complex. (2) (a) Which fluorogenic…
A: When an enzyme comes into complete contact with its substrate, a temporary molecule called the…
Step by step
Solved in 2 steps
- . Some naturally occurring polynucleotide sequences are palindromic; that is, they are self-complementary about an axis of symmetry. Such a sequence is TCAAGTCCATGGACTTGG AGTTCAGGTACCTGAACC Show how this structure might form a double hairpin, or cruciform, conformation. Indicate the center of symmetry in the sequence and the bounds of the cruciform.. A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free - SH group and the other two are involved in an -s-s- bond. A Phe Cys « N-terminus Cys- - Met Cys- C-terminus The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., with disulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the -s-s- bond (i.e., AB, BC, or AC)?E. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o o
- Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.N. HN H3N Where on this amino acid does it attach to a primary sequence of a protein and where is the ionizable position of the R group?
- GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetAAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anThis is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? 1. Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. 2. 3. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-GIn-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met