Q1. (a) Contrast the structural features of starch, glycogen and cellulose. Identify the monomers/subunits of of fat, phospholipids, nucleic acids and proteins. (b)
Q: What is the distinctive molecular composition of lipids?
A: Lipids are macro biomolecules composed of fatty acids and their derivatives, sterols-containing…
Q: Define the structure of starch and glycogen ?
A: Starch is a form of energy storage found in plants. It comprises two glucose-based polymers: amylose…
Q: How would you explain the importance of amino acids andproteins in a diet to a person following a…
A: Nutrition is defined as the process of taking and utilizing food for the building blocks, energy and…
Q: What characteristic differences in molecular structure distinguish lipids and carbohydrates?
A: The biomolecules are the macromolecules that serve as the structural and functional unit of the…
Q: What is the structural differences characterized starch, cellulose, and glycogen ?
A: A biomolecule that has carbon, oxygen, and hydrogen is known as a carbohydrate. It is one of the…
Q: Recognize the modified monosaccharides present in naturally occurring polysaccharides and their…
A: Saccharides with two and three carbons are the most straightforward sugars known in nature.…
Q: Define RQ. What is its value for fats?
A: RQ stands for respiratory quotient. It is the ratio of amount of carbon dioxide evolved to that of…
Q: What is carbohydrates? What functions do carbohydrates serve in living organism?
A: Carbohydrates are polyhydroxy aldehydes or polyhydroxy ketones, or compounds that can be hydrolyzed…
Q: Explain about the Carbohydrate chains ?
A: Introduction: Some molecules are vital for life such as DNA, proteins, carbohydrates, and lipids.…
Q: What are the differences in the polysaccharides cellulose, starch, and glycogen?
A: A polysaccharide is a large molecule made of many smaller monosaccharides. Monosaccharides are…
Q: Please describe the corresponding elements that make carbohydrate, lipids, protein, nucleic acids
A: Biomolecules are composed primarily of the elements :- carbon(c) , nitrogen(N), hydrogen(H),…
Q: Carbohydrates are widely recognized as sources of metabolic energy. What are two other critical…
A: Carbohydrates are simple sugars that consist of Carbon, hydrogen, and oxygen atoms in their…
Q: describe the major types of carbohydrates?
A: Introduction: Carbohydrates are polyhydroxy aldehydes or ketones, or substances that yield such…
Q: Distinguish among saturated, monounsaturated, and polyunsaturated fats.
A: Introduction: Fatty acids are carboxylic acids with hydrocarbon chains ranging from 4 to 36 carbons…
Q: What serves as the basis for the differences between large carbohydrates, proteins, and nucleic…
A: All biological molecules are organic molecules, which means they all contain carbon atoms. Hydrogen,…
Q: A monosaccharide which has a carbonyl function on one of the inner atoms of the carbon chain is…
A: Carbohydrates are compounds made up of carbon, hydrogen, and oxygen. Carbohydrates serve as energy…
Q: How is the definition of “lipid” different from the types of definitions used for other…
A: Biomolecules are the chemical compound which was found in living organisms and these chemicals are…
Q: State the general structure of carbohydrates
A: Carbohydrates are the macromolecules which are source of energy in our body and provide structural…
Q: Illustrate the three-dimensional structure of cellulose and starch ?
A: cellulose and strach both are polysachharides.
Q: Name and describe the three different categories of carbohydrates, including their structures and…
A: Carbohydrate is a group of organic compounds occurring in living tissues and foods in the form of…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: Level Q1 Level 2 Q2 2. What are the building blocks of proteins? Which of the following is not a…
A: As requested by the student the answers to the questions are provided in table form in step 2 on…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: Which of the two polysaccharides contains branched chains of the monosaccharides?
A: The buiding block of all carbohdrates are simple sugars known as monosaccharides. Monosaccharides…
Q: For carbohydrates, lipids, proteins, and nucleic acids, identify their monomers and polymers,…
A: Biomolecules or biological macromolecules are molecules made up of biological elements. These…
Q: 26. Which of the following can be included alongwith biomolecules? (a) Carbohydrate (c) Lipids (e)…
A: A biomolecule, also known as a biological molecule, is a term that refers to molecules found in…
Q: Discuss the structures and functions of carbohydrates.
A: Introduction: Carbohydrates are polyhydroxy aldehydes or ketones, or substances that yield such…
Q: A triglyceride consists of (a) glycerol plus three fatty acids, (b) a sugar-phosphate backbone to…
A: Introduction: The correct choice is option a) glycerol plus three fatty acids
Q: Discuss about the Protein Structure ?
A: The major biomolecules that make up the living world are carbohydrates, nucleic acids, lipids, and…
Q: Describe the chemical structures and general properties of fatty acids, waxes, sterols, fats, and…
A: Lipids are the biomolecule, which exhibits a hydrocarbon chain that is known to form the building…
Q: Describe the building blocks, general structure, and biological functions of carbohydrates.
A: For the proper functioning and growth of the body essential elements and minerals are required.…
Q: Describe five major types of lipids
A: Lipids: These are long polymers of fatty acids containing long non-polar hydrocarbon chains with a…
Q: Why are lipids more energy-dense than carbohydrates?
A: Lipids are a sort of organic molecule that may be found in living organisms. It has an oily or waxy…
Q: An old biochemistry adage is that fats burn in the flame of carbohydrates. What is the molecular…
A: Glycolysis is one of the metabolic processes where glucose is converted to pyruvate. This occurs in…
Q: 19. Which class of carbohydrates consist of two monosaccharides that are covalently bond with one…
A: Carbohydrates, also known as sugar molecules, are sugar molecules. Carbohydrates are one of three…
Q: What structural differences characterize starch, cellulose, and glycogen?
A: A biomolecule that has carbon, oxygen, and hydrogen is known as a carbohydrate. It is one of the…
Q: What is the importance of glycoprotein? Explain briefly.
A: When carbohydrate covalently linked with non-carbohydrate molecule is called as the glycoconjugate.…
Q: discuss comprehensively Distinguish between simple and complex carbohydrates.
A: Carbohydrates are the rich energy source synthesized in the process of photosynthesis. Carbohydrates…
Q: Why are moonlighting proteins necessary and/or desirable?
A: Protein moonlighting is a phenomenon by which a protein can perform more than one function. Most of…
Q: In detail, describe the function of storage polysaccharides vs. structural polysaccharides.
A: Polysaccharides such as starch and glycogen are called storage polysaccharides because they are…
Q: Account for the origin of the term carbohydrate
A: Carbohydrates are a naturally occurring compound defined as polyhydroxy aldehydes or ketones which…
Q: 2b. Identify the subunits (monomers) that make up cellulose. Monosaccharides Glycerol and Fatty Acid…
A: identify the subunit that makes up the cellulose : As cellulose could be a molecule, consisting of…
Q: Illustrate the protein’s structure and function ?
A: Proteins are the biomolecules which are defined as the building blocks of life as they play…
Q: What is the single most important thing for the function of proteins?
A: Introduction : Proteins are polymers with a linear structure. Amino acids are monomer components…
Q: BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : From these enumerated functions…
A: A biomolecule is a carbon-based organic compound that is produced by a living organism. More than 25…
Q: Account for the different structures of glycogen and cellulose.
A: Introduction: Carbohydrates are macromolecules that are comprised of hydrogen, oxygen, and carbon…
PLEASE HELP, LONG ANSWERS WOULD BE APPREACIATED
Step by step
Solved in 2 steps
- the image is the steps for help. Not writing assignment!!!! What is the intended outcome of the lysozyme-based ion exchange chromatography described above? Will the protein be effectively separated using the materials listed in the image, or will it fail? Give a brief explanation for your decision.UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN) a. What are the applications of modern biology in biochemistry? b. What are the implications of these applications? c. How do you think these applications will change the world in the future?Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson arch
- Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCGBIOTECHNOLGY Date: Name: Instructor: Section/Group:. POST-LAB QUESTIONS 1. In one or two sentences, summarize the technique of gel electrophoresis. 2. How does the process of gel electrophoresis separate DNA fragments? 3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process? Biotechnology 165Assignment_12.pdf - Adobe Reader File Edit View Window Help Оpen 1 / 1 99,1% Tools Fill & Sign Comment 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell growth. The recombinant protein can be considered a product of cell culture even though it is not secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as the nitrogen source for aerobic respiration of glucose. The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from glucose is about 20% of that for cells. How much ammonia is required? What is the oxygen demand? If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen requirements for wild-type E. coli that is unable to synthesize recombinant protein? а. b. с. 24°C 08:39 Berawan 27/04/2022
- UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN) a. What are the applications of modern biotechnology in the field of engineering? b. What are the implications of these applications? c. How do you think these applications will change the world in the future?Task 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::8:47 ll 5G% 4 Chapter 9 DNA worksheet 2022.d... 2. Write the mRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5') 3. Refer to the codon chart at the bottom of the page. Translate the mRNA into a polypeptide using the following rules. (2 points) Direction of translation of mRNA is from 5' to 3'. 1. MRNA codons are read in groups of three nucleotides. 3. Translation must begin at the START codon. 4. the STOP codon terminates translation. 2. THIRD LETTER SECOND LETTER U TulUUU Phe UUC Phe UUA Leu UUG Leu A UGU Cys U JUGC Cys C UCU Ser UAU Tyr UCC Ser UAC Tyr UCA Ser UAA STOP UGA STOPA UCG Ser UAG STOPUGG Tp G CCUU Leu CÚC Leu CỦA Leu CUG Leu AJAUU Ile AUC Ile AUA Ile AUG Met STARTACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val CCU Pro CAU His CCC Pro CAC His CCA Pro CAA Gln CCG Pro CAG Gln ACU ThrAAU Asn AGU…
- Final Assessment for Exploring M X forms/d/e/1FAIpQLSe8RrfvHEr59pISGjbEneL041GxKTvyw9-Xc_EA7Um_8xqReA/viewform?hr_submission-Chg1990yzQ8SEAjwvY285... First mRNA base (5) end of codon) A Sequence C Sequence D 5. A DNA sequence of "ACG" will code for the amino acid UUG CUC CUA CUG wh GUC GJA GUG Cys 100 AUU AUC lle ACC AUA ACA AUG MACG] Val M Second mRNA base UCA UCG The GCU GCC.. GCA GIGA CAA CAG Tyr UAC UGC UAA Stop UGA Stop A UAG Stop UGG Tro AAU AAC MT AAC GAC GAG 2 Lys Asp CGA CGG AGU AGC AGA AGG Lys GGU GGC GGA GGG Arg DUAU Gly C Third mRNA base (3' end of codon) Lys (K) DELL C GU A C DEOTOCCAGUCAGUCAGUCHOSOTOS M G (F) A (LS1-1) * GU A C CUGA OPCUGACU GACUSACCO AD A G OCO Trp (W) \u« 9799%3Fo 33 4Explain the advantage of using Fluorescence Recovery After Photobleaching (FRAP) in determining protein localisation I notes = Notes Comments MAY 7.offset=next&assignment ProblemID=218423920 Which of the following statements is FALSE regarding proteins? The three-dimensional shape of a protein is critical for the functioning of that protein. O There is a link between improperly folded proteins and disease in both mad cow disease and Alzheimer's disease. Alzheimer's disease causes proteins in the brain to become improperly folded. O High heat and a change in pH can denature a protein. Submit Part C Request Answer Why does the story in the video start in Colombia? <