Question 5. Read mapping is typically the most computationally-intensive step in RNA-seq data analysis. What features of an RNA sequence read and/or the genome might make read alignment take more time? Would you expect this step to take longer when mapping to the Arabidopsis genome or to the human genome? Why?
Q: Question- You have a new microorganism that you have just isolated. You suspect your bacterium is…
A: By recycling cellulose, the foremost abundant carbohydrate generated by plants, cellulolytic…
Q: Question 4 Review noncoding DNA and multigene families. Match term and its description. Each term…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: with an optimal rate of malt sugar conversion during fermentation. You are provided with the…
A: Introduction Metagenomics is the study of a set of genetic material from a mixed community of…
Q: Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are…
A: Nuclease is the nucleic acid digesting enzyme. Nuclease is of two types 1. exonuclease…
Q: Please answer to best of ability asap
A: Introduction Mutation is described as a change in nucleotide sequence or chromosomal structure that…
Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…
A: Given: Recognition sequence for the enzyme: 5' - GGATCC -3' - Every restriction site is a…
Q: With regards to this sequence below please answer this quistions 1) What is the format of the…
A: answer given below
Q: QUESTION 3: Why does a PCR reaction require a primer? composed of DNA or RNA? Would you expect this…
A: The polymerase chain reaction, or PCR, is a chemical reaction used by molecular biologists to…
Q: When completing genome sequences, contiguous sequences, or contigs are important intermediates.…
A: * A contig refers to series of overlapping DNA sequences that are used to make physical map which…
Q: Question 5: (a) Would the addition of the molecule Actinomycin D affect the production of new HIV…
A: HIV(Human Immunodeficiency Virus) is the most dangerous virus that can affect the body by causing…
Q: QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector.…
A: Ans: The primers are set of oligo-nucleotide sequence used to initiate the synthesis or replication…
Q: When large genomes are sequenced, which of the following is true? Group of answer choices The…
A: Genome is defined as the total complete set of an organism's DNA where it contains of all the…
Q: Imagine you are a cytogeneticist preparing a karyotype, but you forgot to add the Giemsa stain in…
A: G-banding, G banding or Giemsa banding is a technique used in cytogenetics to produce a visible…
Q: a BLASTP
A: Introduction The Basic Local Alignment Search Tool (BLAST) observes districts of nearby similitude…
Q: True or False. In a comparison between the DNAs of related organisms such as humans and mice,…
A: Conserved sequences in related organisms are compared by comparing their proteins.
Q: Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed…
A: In vivo processes are processes done within the cell.In vitro processes are processes done in an…
Q: Question 2 What can we most-accurately say about the polypeptide with the primary sequence KNEADING?…
A: The amino acids are classified on the basis of polarity of the side chain into nonpolar and polar.…
Q: Question 7 What is the function of primase? It O synthesizes an RNA primer. O separates DNA strands.…
A: DNA replication is a process by which two identical copies of dsDNA are produced. It is completed in…
Q: QUESTION 10 You are creating a set of Daphnia mutation accumulation (MA) lines to determine…
A: Mutation is defined as the change in the nucleotide sequence or chromosomal structure resulting in…
Q: Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense…
A: Nonsense mutation is a mutation which occur when a working codon is transformed into one of the…
Q: Question 3 Choose the false statement below. O CRISPR is a protein complex which causes the…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: QUESTION 2 Which of the following statements about nucleic acid synthesizing enzymes (polymerases)…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: Question 30 Which of the following correctly describes a difference between RNA & DNA polymerases?…
A: What is the difference between RNA and DNA polymerase.
Q: What is genetic engineering? What organisms can it be performed on? Please give an example of at…
A: * Genetic engineering is also known as gene manipulation or modification. * It is a process to alter…
Q: QUESTION 2 Which of the following is NOT true of cutting DNA in biotechnology? O A. A molecular…
A: Cutting of DNA It is done by restriction enzymes. When these enzymes come in contact with a shape in…
Q: QUESTION 5 Imagine that you have cloned the gene encoding the SARS-CoV-2 spike protein to a plasmid…
A: DNA cloning is the process of making multiple, identical copies of a particular piece of DNA. In DNA…
Q: The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of…
A: Primers are the set of oligo-nucleotide sequence that is used to initiate the synthesis or…
Q: Question 5: Try cutting Plasmid 1 with Xhol. Xbal. Kpnl, and Pstl. Try cutting with all 4 together.…
A:
Q: QUESTION 20 When comparing the genomes of different species, what region of the genome would you…
A: Comparative genomics is a field of biological research in which the genome sequences of different…
Q: Question 1 A scientist constructs a recombinant bacterial plasmid that contains a gene conferring…
A: Antibiotics are usually defined as the way that they are been medications that are used to treat…
Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: QUESTION 9 Imagine that a researcher has a cell from a genetically engineered organism and a clone…
A: PCR or polymerase chain reaction is a widely used method for amplifying a particular DNA…
Q: QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an…
A: Gel electrophoresis is general lab techniques to determine the quality and quantity of DNA/RNA in…
Q: Question 2. Using the sequences and scoring scheme provided in Question 1, compute the most optimal…
A: A computer programming technique called dynamic programming aids in the speedy resolution of a class…
Q: QUESTION 40 If we had 6 different DNA/RNA nucleotide bases, strings of how many nucleotides would be…
A: Amino acids are the monomers for the formation of peptides or proteins having a chiral carbon with…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: Question 1 A T What is the sequence of the sample DNA submitted for sequencing given the gel…
A: The unknown DNA samples can be sequenced by the Sanger sequencing method. This method is based on…
Q: QUESTION 8 What is the function of the amp' gene in a vector? OA It is a restriction enzyme…
A: A cloning vector is a small piece of DNA that can be stably maintained in an organism, and into…
Q: QUESTION 19 Which of the following is/are true regarding next generation sequencing? Next generation…
A: Next-generation sequencing is a rapid technology that sequences a large amount of DNA in a short…
Q: Question 33 Describe the process of DNA replication in eukaryotes and explain why accuracy is…
A: DNA replication in eukaryotes occurs in three stages: initiation elongation and termination which…
Q: Viral vectors are not the only method being studied for gene therapy purposes. Which of the…
A: Viral vectors are used to transfer a segment of gene into the plasmid or the receipt DNA Many other…
Q: If you wanted to make a cDNA library , which of the following enzymes would you definitely NOT need?…
A: A cDNA library consists of solely the genes that a creature encodes into proteins. Reverse…
Q: Question:- All the necessary ingredients for the Polymerase Chain Reaction (PCR) are mixed together…
A: Uses of thermus aquaticus polymerase in PCR The main reasons that make Thermus aquaticus (Taq)…
Q: Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are…
A: DNA microarrays are a set of DNA probes that are arrayed on a solid platform and used to detect the…
Q: A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA…
A: In this question we have to describe about codon and its translating amino acids. See full answer in…
Q: QUESTION 4: Should PCR primers be complementary to each other?
A: Answer 4-:PCR primers should be complementary to the strands of DNA rather than complementary to…
Q: a) What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the…
A: The field of biotechnology enables us to biosynthesize proteins or genes by inserting a gene of…
Q: Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing…
A: DNA sequencing is a method that gives the order of nucleotide bases. Methods used for DNA sequencing…
Q: Question 1: Which of the following processes is not involved in genetic engineering? A. DNA…
A: The recombinant DNA technology involved transferring the desire DNA into a specific host cells in…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGInstructions: Here is some information about the sequences: All these sequences, “SEQUENCE_21” to “SEQUENCE_27” are in the same subfamily or “clade” of a large phylogenetic alignment of all Rab proteins in these three species (see “Figure 1.pdf”,which is the second image, for a full view of gene family in humans, plants and yeast, see the “D” branch towards the bottom of the tree in Figure 1). “SEQUENCE_28” is a different Rab protein (actually it is the Rab39 protein at the bottom of the tree). “SEQUENCE_21” is from yeast. “SEQUENCE_22” to “SEQUENCE_25” are from the plant, Arabidopsis. “SEQUENCE_26” and “SEQUENCE_27” are from humans. Question: Based on the information above, what can you speculate about the possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent?Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.
- What's the main difference between first-generation sequencing, second-generation sequencing and whole genome amplification.Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisQuestion:- When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.
- Discuss the disadvantages and advantages of both 2D-DIGE and 2D-PAGE.Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' ? b) Assuming that the % GC is = 60%. O (2/10)4 (3/10)² O (3/10)4 (2/10)² O (1/6)4 O (1/4)6 O (6/10)4 (4/10)23.2 INSTRUCTIONS — Do not copy in Google or Bartleby. Plagarize Checker will be used
- Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed in DNA sequencing and how and where would the reaction begin? Also, what raw materials are needed?Question 8. How is the green fluorescent protein (GFP) attached to the protein for which it serves as a label allowing that protein's dynamic activities to be tracked? A. The GFP itself is attached directly to the coding region of the gene of the protein being studied. B. A recombinant RNA is produced by attaching the GFP mRNA to the mRNA of the desired protein. C. GFP adheres specifically to the desired protein via weak interactions. D. The coding region of the GFP gene is joined to the coding region of the gene that encodes the protein being studied.Recall what you know about the rules of gel electrophoresis and the migration of DNA on an electrophoresis gel. The PV92 PCR products could be 941bp or 641bp long. We are calling the longer allele that has the Alu insert the "+" allele and the shorter allele that doesn't have the insert the "-" allele. Which fragment will run faster on the electrophoresis gel, the 941bp or the 641bp allele? 941 641