Regulation of enzyme activity 1. Allosteric control 2. Covalent modification (on/off switch) 3. Proteolytic cleavage 4. Isoenzymes 5. Genetic control (transcription regulation) (enzyme level) How do these types of regulation impact the biochemical processes they regulate?
Q: Which of the following could act as one of the substrates in a reaction catalyzed by a…
A: Let's break it down in detail:Glycosyltransferases are enzymes responsible for catalyzing the…
Q: Import of fatty acids is used for which of the following? (check all that apply) Group of answer…
A: ANSWER WELL EXPLAINED ABOVE
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: The following diagram show what is required for an active promoter of a gene of interest, where:A1 =…
A: Based on the given diagram, here are the predictions:Chromatin conformation: EuchromatinMethylation…
Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…
A: The objective of the question is to calculate the probability that a person who tests positive for…
Q: All of the following are accurate contrasts for beta oxidation vs fatty acid synthesis except which…
A: In both beta-oxidation and fatty acid synthesis, the hydroxylacyl group retains the same…
Q: Only 100% sure experts solve it
A: Approach to solving the question: Detailed explanation: Examples: Key references:Computer Science -…
Q: 13. What value do N-linked saccharides serve for membrane surface proteins? Which amino acid…
A: N-linked saccharides, also known as N-linked glycans, play several crucial roles in the function of…
Q: Draw the skeletal structure of the products formed when the given triacylglycerol is hydrolyzed with…
A:
Q: Please write out the answer/ use diagrams for better understanding.
A: Let me know if you need more help!
Q: The molecule shown below is a monomer of ________. We know this because of the structure of the…
A: The correct answer is: b) DNA; B Explanation: Explanation:The molecule shown in the structure…
Q: Which of the following amino acids have a role in the urea cycle (check all that apply)?…
A: The urea cycle is a crucial metabolic pathway that converts ammonia to urea in the liver, allowing…
Q: -100 100 8. This is a helical wheel projection. The following amino acids of your protein were…
A: IAmphipatric:The term "amphipatric" refers to a type of speciation where a population divides…
Q: Creatine phosphate is used as a phosphoryl donor for ATP synthesis in muscle. It provides ATP for…
A: a) The enzyme creatine kinase catalyzes the production of creatine phosphate. The response is as…
Q: 4) Enzyme 1 and 2 catalyze the same reaction. Both enzymes have the same Km, but Enzyme 1 has a…
A: Km is the Michaelis constant , which is used to determine the affinity of enzyme to its substrate.…
Q: Propose a reasonable stepwise mechanism, using curved arrow notation to show the flow of electrons,…
A: Benzoin to Benzil mechanism:
Q: Please show your work and write it out
A: To answer these questions comprehensively, let's break down the process of glucose production in a…
Q: What does the Michalis-Menten equation tell you? A. The velocity of an enzyme under physiological…
A: Approach to solving the question: Detailed explanation:The Michaelis-Menten equation provides a…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: A single futile cycle, i.e. one round of glycolysis plus one round of gluconeogenesis consumes: 6…
A: According to the given data you can say that 4 ATP ; 0 NADH ( 2 ATP consumed in glycolysis and 2 ATP…
Q: The anticodon _______ can form a Wobble interaction with 5’ UAG 3’? Please note the directionality…
A: Codon is defined as the combination of three ribonucleotides of mRNA. These are complementary to…
Q: (Biochemistry Topic: Electron Transport) Hypotheically, there is an animal which has the reductant…
A: 1. **Pyruvate Oxidation**: In aerobic respiration, the end product of glycolysis, pyruvate, enters…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: Which statements describe electron transport chain events? > NADH releases two hydrogen ions and…
A: The electron transport chain is a system of four protein complexes that oxidise NADH/FADH2 and…
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: Match each protein in the left column with its shape in the right column. Match the words in the…
A: Proteins are high molecular weight polymers that have diverse structural and functional roles within…
Q: Certain bacteria can respire in anoxic environments using arsenic (V) as electron acceptor. The…
A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…
Q: ALL THAT APPLY
A:
Q: List all of the regulatory enzymes from both Glycolysis and Gluconeogenesis, and under each, list…
A: Glycolysis:Hexokinase:(-) Inhibitors: Glucose-6-phosphate (product inhibition)(+) Activators: None…
Q: What is the net yield of ATP when 2 molecules of pyruvate are completely oxidized? (enter numerical…
A: The net yield when 2 molecules of pyruvate are completely oxidized is 20 ATP. When 2 molecules of…
Q: Calculate α' for an inhibitor with KI' = 10.0 nmol L-1 when 100 nmol L-1 of inhibitor is present.
A: Step 1: Given data : Ki = 10.0 nmolL-1 I = 100 nmolL-1 Alpha=? Step 2: Formula: Alpha = 1+ [I] /…
Q: Which statement is true about protein folding? ○ The equilibrium between folded and unfolded states…
A: Please comment down for any doubt. I hope my answer helps you.
Q: Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG…
A: The isoelectric point, also known as the pI, of a protein or peptide is the pH at which it has no…
Q: In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to…
A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…
Q: Suppose the concentration of glucose inside a cell is 0.4 mM and the cell is suspended in a glucose…
A: The following equation describes the mathematical relation for the change in free energy (ΔG)…
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: Approach to solving the question: Detailed explanation:This contains information related to the…
Q: A particular enzyme-catalyzed reaction has an apparent Vmax = 9.00 nmol s-1 and α' = 3.00 when 2.00…
A: Approach to solving the question: Detailed explanation:To calculate the Vmax for the uninhibited…
Q: are best suited for diagnosing a disorder that is caused by low protein expression due to unwanted…
A: Molecular tests are best suited for diagnosing a disorder caused by low protein expression due to…
Q: Model 1 - Linear electron flow during the light reactions Identify each of the numbered elements…
A: Answers are given below:1. O22. H2O3. Primary Acceptor4. Pq (Plastoquinone)5. Cytochrome complex6.…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: Genomic sequencing cannot be used to: Predict a protein coding gene Predict structure and function…
A: Genomic sequencing can be used for tasks such as predicting protein-coding genes, analyzing protein…
Q: Why is 1, 2, 3, 4-tetraphenylcylopentadienone a dark purple color while most other organic compounds…
A: Option a: This option is incorrect because, 1, 2, 3, 4 - tetraphenylcylopentadienone is not a…
Q: What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be…
A: Cholesterol esters are chemical compounds formed by the esterification of cholesterol molecules with…
Q: using results for experiment below conduct 1 graph of the different factors vs rate of enzyme…
A: The objective of this question is to understand the role of different factors in enzyme activity and…
Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…
A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…
Q: (Biochemistry topics: Glycolysis, Citric Acid Cycle, and Electron Transport.) There is a reciprocal…
A: In the reciprocal regulation of glycolytic and gluconeogenic reactions, the interconversion of…
Q: Which of the following scenarios is an example of proximity and orientation effects (select all…
A: The objective of the question is to identify the scenarios that are examples of proximity and…
Q: Below you will find the structures for nurine and pyrimidine. a. Label each structure with its name…
A: a) In the images provided:The structure labeled as "Pyrimidine" represents the basic molecular…
Q: The storage polysaccharide starch is a mixture of the molecules amylose (an unbranched polymer of…
A: Imagine a giant rope made up of multiple strands (like amylopectin). If you wanted to dismantle that…
Q: NO AI GENERATED RESPONSE I NEED EXPERTS!! using results for experiment below conduct 1 graph of the…
A: The objective of this question is to create a graph that visually represents the correlation between…
Step by step
Solved in 2 steps
- Define the following terms:a. proproteinb. preproproteinc. disulfide exchanged. proline hydroxylatione. proteolytic cleavageWhich of the following is true of nuclear regulatory effects, as compared to cytosolic regulatory effects? they begin faster, they have a longer duration of effect they have a shorter duration of effect they are the same. it's not known14) Which of the following correctly ranks the steps in the secretory pathway? 1. Active PKA subunits phosphorylate targets in the cell, regulating function. 2. The catalytic subunits of PKA dissociate. 3. Gprotein a subunit exchanges bound GDP for GTP. 4. CAMP binds to the regulatory subunits of PKA, activating it. 5. Ga subunit dissociates from complex and activates adenylate cyclase. 6. Ligand (hormone) binds to receptor. 7. Activated adenylate cyclase produces CAMP from ATP.
- Tumor necrosis factor (TNF) signaling Explain in detail each step in figure 8.53. Make sure to include an explanation of the proteolytic and phosphorylation cascades.Tab. 6. Mechanisms of intracellular accumulation of substances (Intracellular Accumulations or parenchymal dystrophies) 1. Normal cell Protein mutation Complex substrate Soluble products Enzyme Abnormal metabolism Defect in protein folding, transport -X-> Lack of enzyme Fatty liver 4 Ingestion of indigestible materials Accumulation of abnormal proteins Complex substrate Lysosomal storage disease: accumulation of endogenous materials Accumulation of exogenous materials 12. 3. 4.Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms can be used once, more than once, or not at all. Submit dCTP GMP AMP GTP dTTP activation inhibition dGTP My Answers Give Up UTP + Gln + ATP → CTP + Glu+ ADP + P₁. Cofactor: dCMP + H₂O →→→→DUMP + NH3. Cofactor: CDP+ [2H] → dCDP+ H₂O. Cofactor: Effect: Effect: Effect: Reset Help
- Which of the following five processes are points of regulation for controlling enzyme-mediated reactions? Select 5 correct answer(s) Dihydrolipidation of arginine Disulfide bond acetylation Protein targeting RNA processing Cytosine methylation Proteolytic processing Protein degradationAutophagy is an évolutionary conserved catabolic process devoted to the degradation of intracellular components. Which of the following would you observe during autophagy? Select all that apply MTOR inhibition through phosphorylation and activation of TSC proteins MTOR activation and phosphorylation of downstream target proteins Increased expression of Rab7 which mediates lysosomal fusion Acute inflammatory responseDefine the following terms: a. proteolytic cleavage b. proproteins c. preproproteins d. hydroxylation e. phosphorylation
- 3. Suggest a role for ActA in addition to Arp2/3 complex mediated actin polymerization. Extend the watermelon seed analogy used in the lecture. Compare wild-type Listeria with the ActA mutant. If the watermelon seed is Listeria and your fingers are a comet tail, what would the outcome be when squeezing your fingers when using wild-type Listeria, what would you expect when using the mutant? Answer Here: One role for ActA in addition to Arp2/3 complex mediationHuman cells are highly resistant to transformation. Experiments have shown that 5 regulatory circuits (pathways) have to be altered before human cells can grow as tumor cells in immunocompromised mice. State each of these circuits. Explain how the alteration of the protein of that particular circuit leads to uncontrolled growth.39. Which ONE of the following action would be most selectively toxic against bacterial cell? Group of answer choices inhibiting DNA replication preventing cell wall synthesis interrupting peptidyl transferase functions targeting codon : anticodon interaction disturbing cell membrane integrity 40. Identify the TRUE statement from the following, Group of answer choices superantigens are made by our body’s cell superantigens inhbits cytokines release Bacillus anthracis secreted toxin is a superantigen Staphylococcus toxic shock syndrome toxin is a superantigen superantigens activates B cells of defense system