Rotations around bonds in a peptide sequence 20) DNA and RNA based techniques
Q: Create a mind map for amino acids.
A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…
Q: What reaction does the enzyme triose phosphate isomerase catalyze? O Conversion of dihydroxyacetone…
A: Glycolysis is a series of 10 reactions which enable the cells to convert 1 molecule of glucose to 2…
Q: Examine the structure below and answer the questions. (C) R H N OH a. Identify the type of molecule…
A: Biomolecules are the very essential macro molecules for the metabolism of the cell and the survival…
Q: 3. Listed below are four redox couples. An organotroph uses compounds from two of these to carry out…
A: Oxidation and reduction reactions occur in synchrony within the cells. The Oxidation of one…
Q: How to prepare Figure 1:. (Refer to Postlab photo of gel for an example.
A: Electrophoresis is the movement of mixture of protein (uniformly negatively charged with SDS) on gel…
Q: Which of the following acids is a vitamin? (i) Aspartic acid (ii) Adipic acid (iii) Ascorbic acid…
A: The acid that is a vitamin is option (iii) Ascorbic acid. Ascorbic acid is also known as Vitamin C.…
Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…
A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…
Q: The typical human adult uses about 160 g of glucose per day. Of this, the brain alone uses 120 g.…
A: Fatty acids from triacylglycerols also should include in answer. After the glucose reserve has been…
Q: A segment of a protein-encoding gene sequence is given below. 5’-AAGTTTGGCACT-3’…
A: Transcription is the process by which the genetic information encoded in DNA is copied into a…
Q: How can I found the log of molecular weight ? Please
A: Proteins are the building blocks of the body. They are made up of amino acids. Proteins are polymers…
Q: 15. A mother who is homozygous type A and a father who is homozygous type B will have a child with…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 1.Which of the following molecules consist of a chain of amino acids? Select all that apply. A.…
A: Amino acids - alpha carbon of amino acids contains amine group, carboxyl group and side chain group.…
Q: Fatty acids can be gluconeogenic precursors in plants, but not animals. O True O False
A: Gluconeogenesis is a metabolic process that occurs in the liver and kidneys. It allows the body make…
Q: The diagram below represents genes (indicted by letters) on two nonhomologous chromosomes, where the…
A: A mutation is a change in an organism's genetic material (DNA sequence). It can happen naturally or…
Q: Give one example each of di-, tri- and tetra-saccharides.
A: Introduction: Di-, tri-, and tetra-saccharides are types of carbohydrates that consist of two,…
Q: Which of the following amino acids is non polar at ph 7
A: Amino acids are usually polar molecules and their polarity is the result of amino group (-NH2) and…
Q: At pH 7, draw the structure of Arg-Tyr-Gln-Glu-Lys. 2. What’s the charge of this peptide at pH 12?…
A: 1. At pH 7, the Arg-Tyr-Gln-Glu-Lys peptide would have the following structure: H H H…
Q: What is the difference between a ligand-gated channel (like H1 or the AChR) and a voltage gated…
A: Introduction Plasma membrane is the outermost covering of animal cell. It protects the cell from the…
Q: 1. You are investigating the kinetic properties of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).…
A: GAPDH is an important enzyme involved in the process of glycolysis, a metabolic pathway that…
Q: Chitin is a storage form of fuel in plant cells is the storage form of glucose in animals provides…
A: Biomolecules are molecules found in living organisms that play a role in their chemistry. They are…
Q: What sets metalloproteins different from glycoproteins?
A: Proteins are basis of cellular life as they perform enzymatic functions and form structural basis of…
Q: the strength of a ligand-protein binding is known as the binding sites a. conformation b.…
A: Protein ligand binding is a non-covalent binding between protein and ligand. This binding is…
Q: How may online resources improve one's health? Distinguishing telesurgery from telemedicine, what…
A: Online resources can have a significant impact on improving one's health in several ways. Some of…
Q: Fill in the blanks below using the correct molecule from above A I can combine to form starch…
A: Biomolecules are molecules that are present in living organisms. Biomolecules are broadly classified…
Q: In two hours of a frozen potato the enzymes and molecules what happens to them
A: When a potato is frozen, the enzymes and molecules within it undergo several changes. During the two…
Q: A woman of 40 years old was found to have an increased basal metabolism. Explain the excess of which…
A: Basal metabolism refers to the amount of energy the body uses at rest to carry out basic…
Q: How many amino acids make up the unknown protein? How many nucleotides in the mRNA transcript? How…
A: Proteins are polymers of amino acids linked by peptide/amide bonds by the condensation reaction…
Q: What method do ELISA’s utilize in their measurement? a) light absorption (eg Abs480nm) b)…
A: Measurements in biochemistry are essential to understanding the structure, function, and…
Q: Glucose-phosphate production by an enzyme extracted from cells taken from the much-feared Lilyputin…
A: Hexokinase catalyze the conversion (phosphorylation) of Glucose to Glucose 6 phosphate (mentioned as…
Q: What are the fundamental principles that underpin the distinctions between big polysaccharides,…
A: Biopolymers such as polysaccharides, proteins, and nucleic acids are three important classes of…
Q: How can I measure the distance in (mm) of both protein A & B please
A: Polyacrylamide gel electrophoresis (PAGE) is a technique for separating molecules depending on their…
Q: 13. In the last step of the absorption-elution method only type B cells cause an agglutination…
A: 13. If only type B cells caused an agglutination reaction in the last step of the absorption-elution…
Q: cephalin phospatidyl ethanolamine Yields 2 fatty acids, phosphoric acid, glycerol, and…
A: The major classes of biological macromolecules are nucleic acids, proteins, carbohydrates and…
Q: Molecular diameters of proteins IgG and TNFα are 11.2 nm and 4.4 nm, respectively. The diffusion…
A: Stokes-Einstein equation is the relationship between diameter and diffusion coefficient of a…
Q: Choices: -cerebroside -monoglycosyl ceramide -glycosphingolipid -all are correct
A: The given figure contains a sugar and a ceramide. Such type of molecule is found in the myelin…
Q: The partial sequence of one strand of a double-stranded DNA molecule is…
A: EcoR1 and Pst1 are types of restriction endonuclease, that have the property of cleaving the DNA at…
Q: if the tetrapeptide shown in the binding site above (Gly-Ser-His-lle) were in an aqueous solution at…
A: Charge of a peptide depends on the pKa of the amino acids. Every Amino acid has a side chain along…
Q: Rapid regulation of pyruvate dehydrogenase complex is achieved via which of the following?…
A: Pyruvate is the end product of glycolysis. Under aerobic conditions, pyruvate is oxidised into…
Q: Proten MW (KD Log of MW V Migration Distance (mr RF
A: This is a case of tables in excel. To remove the arrow, follow the steps below
Q: Glyceraldehyde 3-phosphate + P₁ + NAD+ →→→ 1,3-bisphosphoglycerate + NADH + H+…
A: The payoff phase consists of 5 reactions that involves the conversion of Glyceraldehyde 3 Phosphate…
Q: Answer Bank Glyceraldehyde 3-phosphate + P¡ + NAD+ →→→ 1,3-bis 3-Phosphoglycerate →→→…
A: Glycolysis is the first phase in aerobic cellular respiration. It is the step during which one…
Q: Define phospholipids. Classify them with suitable examples and state their functions.
A: Introduction; Phospholipids are a type of lipid molecule that are essential components of cell…
Q: 5. Consider the thermodynamics of DNA replication. What are the different thermodynamic parameters…
A: Central dogma states that the flow of information is unidirectional and irreversible, i.e.…
Q: what does this have to do with lactose or lactose into
A: The cell membrane is the structure that physically separates the inside of the cell from the…
Q: Mevalonic acid high or low in vegetarian diet?
A: Mevalonic acid is a key intermediate compound in the biosynthesis of isoprenoids, a large class of…
Q: ATP yield from glycolysis, TCA cycle and oxidative phospharylation (a) Compute the theoretical ATP…
A: Muscle cells can be cardiac muscle cells or skeletal muscle cells. The pair of electrons in NADH…
Q: The peptide below is placed into a buffer with a pH = 9.1 H₂N-CH-C- -NH–CH—CNHCHC NH–CH CH3 HỌ-CH,…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: What is the correct order of enzyme action during DNA replication? O Priming, helicase/topoisomerase…
A: DNA replication is the process by which a cell copies its entire genome to pass on to its daughter…
Q: Nerve growth factor binds to which type of receptor? a.) Receptor tyrosine phosphatases b.)…
A: Receptors are present on the cells surface. These receptors can bind to different signals received…
Q: Can you illustrate the detailed process of cellulose degradation in a flowchart, including the…
A: Cellulose degradation is the process of breaking down cellulose, which is a complex carbohydrate…
19) Rotations around bonds in a peptide sequence
20) DNA and RNA based techniques
Step by step
Solved in 2 steps
- 47. Protein Sequencing Applies changes in pH to separate amino acids Applies changes in pH to separate polypeptide chains Maintains disulfide bonds for stability Identify the 5' and 3' terminals on the protein 48. Directional sequencing of proteins is achieved by initial separation by molecular weight and subsequent separation by point Certain FakeSDS-poly- Protein spot acrylamide slab Two-dimensional gel electrophoresis is used to separate and identify all of the proteins found in a sample. Electrophoresis is performed in the horizontal direction first, then the vertical direction. Which property of proteins causes these molecules to move to different locations in the horizontal direction? • Which property of proteins causes these molecules to move at different rates in the vertical direction? Direction of electrophoresisDiscuss the benefits of being able to predict protein structure from the DNA sequence (proteomics).
- The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humans(True or False) 1.) Fatty acids can be found in ceramides and TAGs. 2.) The adenine base can easily form hydrogen bonds with thymine with the least energy requirement. 3.) The 3'end of nucleic acids structurally has a free OH group bonded to the 3' carbon of the sugar. 4.) Naturally occurring RNA molecules are always single stranded in the cell 5.) The Watson and Crick double stranded DNA structure is always antiparallel.Sketch the appearance after visualization of a protein mixture containing the seven proteins above when subjected to two-dimensional (2D) gel electrophoresis.
- Topic: Nucleic Acids (DNA) Explain “the two strands are antiparallel”.The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-Kb. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hp
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21How do I identify which nitrogenous base is which in a DNA and RNA polymer? I am looking at a 2D model with a polymer of RNA and the textbook is asking me to identify the base's letter.A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both parts