Sanger Sequencing Questions Q5. What are the applications of this sequencing technique? Q6. Draw the schematic representation of a chromato gram for the DNA template with this sequence:3 prime GATCCGCA 5 prime
Q: Q6) Why are ‘sticky ends’ useful biotechnologically? Q7) Why is this enzyme called a restriction…
A: When restriction enzymes cut between two bases on the same strand at one end of the sequence and two…
Q: Q3. Determine the total amount of YGM solution you'll need next week in Part 1B, and add to that a…
A: Answer and Calculation:
Q: Lesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the…
A: Introduction: Polymerase chain reaction (PCR) is a laboratory method used to rapidly produce…
Q: 18. What does "highly variable" mean? 19. Why are highly variable regions important in this lab? 20.…
A: Polymerase Chain Reaction ( PCR )-- PCR was first developed in year 1983 by Kary Mullis .Polymerase…
Q: Task 2: Polymerase Chain Reaction After purifying the gDNA extract, you want to isolate and amplify…
A: Introduction : PCR (Polymerase Chain Reaction) : Polymerase Chain Reaction (PCR) Is A Method For…
Q: Q16. What is the role of the DnaA protein in DNA replication? It binds to a DNA sequence that is…
A: DNA replication is the biological process of making two identical replicas of DNA from a single…
Q: (Q134) What is the function of topoisomerase? A) To facilitate unwinding by introducing positive…
A: The process by which a DNA molecule synthesizers it's own identical copies is known as DNA…
Q: Abands). Please, àdestity he 10. Samples were tested for sickle cell disease by PCR. The results…
A: HbA is the normal adult hemoglobin and HbS is the mutated one causing sickle-cell anemia. The…
Q: What are F plasmids? What are resistance plasmids? Include in your answer -the functions for each…
A: Plasmids are circular extra-chromosomal autonomously replicating DNA that has diverse functions.…
Q: GENETIC TIPS THE QUESTION: In the Western blot shown here, proteins were extracted from red blood…
A: Step 1 Western blot is a technique that is used to detect specific proteins in a specimen of tissue…
Q: 24. Arrange the correct sequence in southern blotting. I. DNA extracted from white cells and are…
A: The technique of transfer of gel to a membrane from the gel for the detection of sample on the…
Q: Why transgene copy number is a key concern for transgenic studies? Describe an efficient method for…
A: Introduction of exogenous DNA into the genome using techniques like transformation, transfection,…
Q: All questions a) What is the DNA base sequence of Codon 1? b) What is the anticodon sequence for…
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: question on plasmid minipreps and restriction digestion What role does the combination of alcohol…
A: Plasmids are extrachromosomal double stranded circular molecules of DNA found in the cytoplasm of…
Q: Codominance: 1. In some chickens, the gene for feather color is controlled by codominance. The…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what…
A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…
Q: Task 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…
A: BASIC INFORMATION PCR It is time for polymerase chain reaction. It is a method to amplify small…
Q: Questions: 1. Why are plasmids used as vector for DNA Recombination? What other vectors can be used?
A: Note - we answer one question at a time. In the DNA recombination process, the specialized…
Q: PRE-LAB QUESTIONS 1. Explain why DNA has an overall negative charge. Think back to the molecular…
A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of cell…
Q: WORKSHEET TASK 3: 1. Below is a theoretical section of DNA. Design two primers that are 10 base…
A: In the mid-1980s, an important revolu- tionary technique of molecular biology PCR or Polymerase…
Q: ACTIVITY 2. COVID-19 RT-PCR TEST Directions: This is a manual simulation of COVID-19 RT-PCR test.…
A: In order to identify the DNA sequence is belonging to SARS CoV-2, the final protein products…
Q: What are things that are common in cloning vectors? Why are they useful?
A: You have asked multiple questions. According to our guidelines we are instructed to answer the first…
Q: Conclusions and Future utility about DNA Barcoding and Woolly mammoth diet mystery solved by DNA…
A: As per Your Question We discussed about DNA Barcoding: Answer : DNA barcode is the latest genetic…
Q: ARS-CoV-2 has 30,000 nucleotides? How long is this compared to bacterial genomes and to human…
A: Answer: Nucleotides are the nitrogen containing bases ( adenine, thymine , cytosine , guanine ) ,…
Q: Explain your answer and cite references in APA format. 1. What does mashing do to the fruit? 2. Why…
A: Introduction DNA extraction is a technique for isolating DNA from cell membranes, proteins, and…
Q: Discussion for lab report of isolation, purification and quantification of bacterial DNA.
A: Ans: DNA: The deoxyribonucleic acid (DNA) is the genetic material present in the prokaryotes.
Q: Legrning Task 2: Make da Then, answer the gulde questions that follow. Materlals: crayons. Scissors,…
A: DNA replication is process where DNA makes multiple copy of it's genome and produce same identical…
Q: 11-3 Use his- strand bacteria describe an Ames test and list hypothetical outcomes for these…
A: The Ames test is used bacteria to test whether a given chemical can cause mutations in the DNA of…
Q: What do you think are the crucial steps in Polymerase Chain Reaction technique? Enumerate the…
A: Polymerase Chain Reaction: The polymerase chain reaction (PCR) was invented in 1983 by Cetus…
Q: 29 Martian Microbe continued If the Martian Microbe replicates DNA in a fashion similar to Earth…
A: DNA replication occurs in 5'to 3'.
Q: Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide…
A: The gene or small portion of DNA undegoes transciption to form mRNA and then this mRNA undergoes…
Q: (Subject - Development Biology) 1. It is a chemical substances causing developmental abnormalities…
A: Most birth defects happen during the first 3 months of pregnancy. For example, cleft lip or neural…
Q: Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood…
A: With the advent of biotechnology and genetic engineering, several achievements have been made in…
Q: GalK Section/Counterselection When galK is replaced with the gene of interest, these bacteria are…
A: GalK gene is part of the galactose operon and codes for the galactokinase enzyme. Galactokinase…
Q: What information, and what reagents would you need to use PCR to detect HIV in a blood sample?
A: AIDS is caused by HIV, which impairs the body's ability to fight infections. Contact with infected…
Q: What is the enzyme that eventually joins the sugar-phosphate backbones of the Okazaki fragments and…
A: DNA recombination technology is a technique in which foreign DNA is joined with host DNA to form…
Q: Q11) Explain, using the pCR 2.1 vector, what we would see if we try to grow cells on a plate with…
A: Blue-white bacterial colony screening is a common and successful molecular biology approach that is…
Q: o Acid uence /hich kind of protein molecule did this gene make? How does this protein help the body…
A: DNA is transcribed to produce RNA and RNA is translated to produce protein proteins are made up of…
Q: Chhose correct option plz QUESTION- The SARS-COV-2 virus interacts with a human protein present on…
A: The technique of altering DNA in an organism's genome is known as genetic engineering. Changes or…
Q: 17. Spinocerebellar Ataxia Type 2 is a trinucleotide expansion disorder. Normal individuals have up…
A: The normal individuals have 32 trinucleotide repeates whereas, the individuals having 33 or more…
Q: Mesosomes b) Plasmids c) LPS d) O antigen e) H antigen f) Capsule g) flagella h) pili i)…
A: Bacteria is a microscopic and non availability of well developed apparatus to view the structure of…
Q: Lab 10- PCR For the following equipment, know what it looks like, its name, and its function:…
A: 1) A micropipette is a laboratory instrument used to accurately and precisely transfer volumes…
Q: Topic: Isolation of E. coli bacteriophage What would happen if: - the enrichment method in the…
A: 1. The enrichment method includes the use of enrichment broth which is essential for the growth of a…
Q: mosaic virus is considered to be an open capsid because: A: The capsid uses icosahedral symmetry…
A: Tobacco mosaic virus is roughly rod-shaped virus. it was isolated in the crystalline form by WM…
Q: UCSC Genome Browser on D. melanogaster July 2014 (Gene) Assembly (dm3gene) move » >>> zoom in 1.5x…
A: Exons are the coding region and these exons result in the formation of functional protein or enzyme.
Q: Q4. For the analysis of DNA fragments in agarose gel, we use DNA ladder (depending on your sample…
A: DNA ladder is a solution containing known different molecular weight dsDNA, which is used to…
Q: Doc -2 Therapeutic Drugs Doc-1-Introduction: Specific applicati ons of genetic engineening are…
A: Genetic engineering is defined as the process of utilizing recombinant DNA (rDNA) technology to…
Q: Q4) What are the 3 main components required for cloning? Q5) What is 16S rDNA, and why would…
A: DNA cloning is a molecular technique that forms many identical copies of a piece of DNA, like genes…
Please all question solve
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Save On 13 2 Manipulating DNA pages 322_323 task - Last Modified: Mon at 1:11 PM - Makama, Aisha B. MA Home Insert Draw Design Layout References Mailings Review View Help A Share 1) Develop an analogy for the processes researchers use to make changes to DNA. In your analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well as the protocol for setting up and running a gel. You can add diagrams to the flowchart and add detailed notes if you like. DFocus 9:46 PM 2122/2021 135 words English (United States) Page 1 of 1 P Type here to searchHelp Please Supercoiled DNA migrates through an agorose gel faster than similarly sized linear DNA? True or False? Using the plasmid map, indicate where (bp region on plasmid) these enzymes cut on the plasmid. EcoR1 1. 1 Hindlll 2. 637 Bpu101 3. 14 BamHI 4. 256 To sequence a DNA plasmid, you need 1 µg of DNA. If your DNA concentration was 0.45 µg/µL. How many µl of your DNA 0.45 µg/µL is required to get 1 µg final? Answer in µl using 2 decimal places. Your Answer: Answer units >Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer
- ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ONRestriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:u+ 2:24 * © . Fundamental of Bio-informa.. Log out DAMINOV AKHMADILLO on 3 In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is ed I out of Select one: g O 1. log2(n) on O 2. nlogn 3. n O 4. None of above 个 TOP
- Legrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds Then, answer the gulde questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape across…Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb