Scientists studies pocket mice living on dark volcanic rock in both New Mexico and fifty miles away. They recorded their chart below. State one possible hypothesis that would explain the differences in the observed data between the two locations. PLEASE USE THE NUMBERS IN THE GRAPH IN YOUR ANSWER.
Q: "Life has shaped earth just by existing”. In 2-3 sentences, explain this statement briefly by citing…
A: Life is a complex entity and it does not formed in just one day. Millions and millions of years…
Q: Use the image to answer questions American Raccoon Alligator Southern Leopard Frog Eastern Mud…
A: Many food chains entangle to form a food web where various trophic levels of different food chains…
Q: Use the diagram below to answer the questions that follows 1) what type of plate boundary occurs at…
A: ANS1. The plate boundary that occurs at X is the mid-ocean ridge or spreading center. The mid-ocean…
Q: Explain briefly the following term used scientific researches; Hypothesis and theory
A: Scientific research discloses a great deal about the unknown. Its goal is to discover and explain…
Q: Select the correct terms: The process of science begins with a(n) (prediction / observation) about…
A: The scientific method is an empirical method of acquiring knowledge that has characterized the…
Q: Use the sources to answer the following question. Source A Black ladybugs with red spots are…
A: Melanin is a pigment that is secreted by the cells that helps in determining the skin color of…
Q: Conclusion: Write a conclusion based on your answers and data. Your conclusion should answer the…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Food Webs Food webs are helpful diagrams to understand the relationships of organisms within a…
A: Food chain: The process of transfer of food energy from producers to the consumers by eating and…
Q: The data table shows the changes on the human population over time. on the grid below, label and…
A: Introduction The term "population" usually refers to the number of people living in a specific area,…
Q: What I Have Learned If humans were concerned about biological diversity, would it be best to have a…
A: Biodiversity is typically a measure of variation at the genetic, species, and ecosystem level.…
Q: Which statement below correctly identifies the difference between laws and theories? Laws describe…
A: A scientific law describes an observed pattern found in nature without explaining it. The theory is…
Q: Sampling is a process of selecting a portion of population to represent the entire population. Name…
A: Sampling is a method of picking single members or a subset of the community to make mathematical…
Q: A drug company performed a study to test the effectiveness of a new headache medicine. The…
A: A drug is a substance that may have a certain physiological effect on the body. In medicine drug is…
Q: Question 8 The invention of microscope pushed discoveries in biology to new heights. This shows how…
A: The essence of science and technology is to contribute to society. Technology has a significant…
Q: Use the picture below to answer the question. Coastal Bay Food Chain Algae Barracuda Damselfish…
A: The provided diagram describes the food chain of the coastal waters of Virginia. The food chain…
Q: QUESTION 2 Approximately when did living things first appear on land? O 4.75 billion years ago O 3.5…
A: The age of the earth is estimated to be about 4.54 billion years. When the earth was formed for the…
Q: What is the unit temperature for biology measurement called? A) Celsius B) Fahrenheit C) Kelvin D)…
A: In biology, temperature is one of the major factors responsible for the survival of the organism. It…
Q: Difference between two organism of the same species is called
A: Species is the basic unit of classification in taxonomy.Species is a group of individuals that share…
Q: The biggest living in earth?
A: Introduction Biodiversity refers to the availability of different types of species of different taxa…
Q: Match the terms with the most suitable description. ______data a. if–then statement…
A: Introduction :- Autotrophs, often known as producers, are organisms that produce their own…
Q: Suppose you observe that all of the fish in a pond have disappeared. Explain how you might use the…
A: Fishes die due to a number of reasons, such as old-age, starvation, injuries, suffocation,…
Q: Which conclusion is best supported by a comparison of these two photographs? The photograph on the…
A: Humans, Homo sapiens, are the most intelligent living organisms on the earth. The lack of strength…
Q: In David Attenborough's Tree of Life video, he suggests the first life forms on Earth were worms.…
A: David Attenborough's Tree of Life is an explanation about how life started and developed on earth.…
Q: Explain the difference between anecdotal and scientific evidence. Which do you think is more…
A: An experiment is an organised set of practicals carried out to validate the hypothesis. The number…
Q: Make a prediction and devise a suitably controlled experiment to test each of the following…
A: It is known that a controlled experiment would have a control group and an experimental group which…
Q: latch the terms with the most suitable descriptior data _probability b. unique type of organism…
A: Autotrophs, also referred to as producers, are organisms that generate their own food. They are the…
Q: For how long has there been life on Earth? For what percentage of time has life existed on Earth?…
A: Any net lateral change or continuous change in the traits of species or populations over several…
Q: Choose one theory that you think best explains the origin of the universe.
A: Since the 1980s, RNA World has been the prevailing theory regarding the origin of life. The…
Q: Use the sources to answer the following question. Source A Black ladybugs with red spots are…
A: Climate change causes ladybugs to change hue. Paul Brakefield and colleagues researched the…
Q: A person tells you that evolution is just a theory, like the big bang theory explain to that person…
A: Evolution: The process by which different species of living organisms are believed to have developed…
Q: What can you infer from the fact that minor changes in water temperature can kill entire species? A.…
A: Bacteria are microscopic organisms which belong to prokaryote because these are unicellular…
Q: why would understanding the origins of life on earth help with discovering life on other planets
A: * Earth is the planet which supports most of the habitats. * The origin of life on earth is the…
Q: Choose the correct order of appearance on Earth
A: The first kingdom to dominate earth is definitely prokaryotes because of the simplicity of structure…
Q: A scientific theory A speculation of what you think might happen based on previously acquired…
A: According to the question, we have to describe what is a scientific theory. So, let us have a look…
Q: Which conclusion can be made from these diagrams? O A Plant and animal cells interact to make new…
A: Both the plants and animal cells require oxygen to release the energy stored in food through a…
Q: Give 1 reason from the reading that shows that there are no life forms on Venus.
A: Venus is the second planet in our solar system that is named after a female. It is slightly smaller…
Q: book icon 1. The term ecology comes from Greek words meaning O A. the science of living things O B.…
A: as per the guidelines we are supposed to answer only first question in case of multiple posted.…
Q: Provide a rigorous and reasonable (scientific if possible) example that uses the scientific method.…
A: 1. Observation method example- any scientific survey like if a scientist need to calculate average…
Q: In the figure above, structure A is and structure B is
A: The corti is a complex epithelial structure in the cochlea that contains hundreds of hair cells and…
Q: 1 2 3 Number of Weeks after the Forest Fire
A: The image depicts the phenomenon of natural selection.
Q: Scientists studied pocket mice living on dark volcanic rock in both New Mexico and fifty miles away…
A: one possible hypothesis that would explain the differences in the observed data between the two…
Q: Use the following information to answer the next question. Two populations of birds were studied in…
A: A population is a group of organisms of a species sharing common habitat at a given time. Characters…
Q: Choose the answer from the given concept below. A. Extraterrestial Origin B. Divine Creation C.…
A: The meaning of 'Origin of life' is the emergence of heritable and evolvable self-reproduction. It is…
Q: Scenario 1: You are running a marathon and observe that running increases your pulse rate. Using…
A: The pulse rate, or the number of times the heart beats per minute, is a measurement of the heart…
Q: Suppose that you are studying the effectiveness of a newly developed drug. You notice that the drug…
A: Clinical Trials is a research performed on a small group of individuals to evaluate medical,…
Q: Four of the five answers listed below are names of kingdoms. Select the exception.
A: The organisms of the ecosystem have significant properties. Depending upon the different features of…
Q: First is the occurrence of (1) found in geologic strata. Write the answer for #1
A: Introduction Strata are layers of rock, it forms during sediment deposition, that is, the laying…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- ory X Gakg614 micro x Mail - Kayli Je X Google Docs ×X + ua/la/launch/49049728/45384876/aHR0cHM6Ly9mMi5hcHAUZWRtZW50dW0uY29tL2xlYXJuZXItdWkvc2Vjb25kYXJ5L3VzZXItYXNzaWdubWVudC800TA0OTC 1 Select the correct answer from each drop-down menu. In an experiment, a scientist decides to study the effect of exercise on cholesterol levels in people. He studies two set of people-those who exercise every day for an hour and those who don't exercise at all. In this case, the statement that people who exercise for an hour may have lower cholesterol levels is ✓. To test this statement, the scientist would measure cholesterol levels in exercisers and non-exercisers. The cholesterol levels would be Reset Next 6 ←Marit X K Marit x K Marit x K Marit x K Marit X K Marit x K Marit x K mea X amihq.com/web/viewer.html?state=%7B"ids"%3A%5B"1Pnete_jWal4wBT4oiRDhFTYO4KGTeuMI"%5D%2C"action"%3A"op P A Kami Schoolo. X-linked Traits Assignment.pdf 100% Times New Roman 14px 1.5pt : BIUS A A X2 x2 E E Gemeuux. A LIIKCU Genes In fruit flies, eye color is a sex linked trait. Red is dominant to white. 1. What are the sexes and eye colors of flies with the following genotypes: XRX' XRXR XRY XY L 2. What are the genotypes of these flies: white eyed, male white eyed, female red eyed female (heterozygous) red eyed, male 3. Show the cross of a white eyed female X 'X'with a red-eyed male X Y 4. Show a cross between a pure red eyed female and a white eyed male. What are the genotypes of the parents: & How many are: white eyed, male white eyed, female red eyed, male red eyed, femaleCATGATACAAGGCCCTTCCGGTACAACCACTTCGGTAGAAAGCCTTTCGGAGACCGTCCCTTOGGCAGACGCAACmI cear CA PESCA CROOngm O uaNOCIGa P L CEIC00PORMORlg mcaGccCTTCCGGT 916 10 5'UTR 20|JATG 3b 50 Leader 60 80 100 1 110 130 160 2 40 70 90 120 140 150 170 180 190 ....I....I....I....I.. ..r....I........I....I....I....I....I....I........I....I....I....I....I....I....l....I....I........I....I....I.......I....I....I....I....I....I....I.........I .1....I.... DQ183132 DQ183133 DQ183134 ...2 -TCGGAGAGACTATTACTAACATG TCGGAGAGACСТАТТАСТААФАТО TCGGAGAGACCTATTACTAACATG 3 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCCCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCGCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185…dIM079 Gla cwin Cr X e Bacteria and Protists Tutorial S Learner Home com/courseware-delivery/ua/49361195/45451171/aHROcHM6Ly9mMS5hcHAuZWRIZW50dWOuY29tL2xIYXJuZXItdWkvdXNIch hc3NpZ25tZW50LzQ5MZYXMTKI 2h Eeria and Protists: Tutorial 15 of 34 E Save & E Type your response in the box. The developmnent of antibiotics has revolutionized the treatment of infectious diseases. However, antibiotic overuse is a major contributor to the development of antibiotic-resistant bacteria. Antibiotic resistance is a genetic trait. What effect could antibiotic-resistant bacteria have on the population? antibiotic capsule antibiotic antibiotic damages cell wall cannot damage cell wall bacteria B IUX X, Font Sizes Aholyoke community college - Se x H Holyoke Community College | H X in Chapter 1 Question Set- Due 5/2 x C https://moodle.hcc.edu/mod/quiz/attempt.php?attempt=1391804&cmid=1678584 HCC Online English (United States) (en_us) ▼ Sn 1 Which of the following is not a fundamental characteristic of living organisms? et Select one: O a. made of cells O b. acquire and use energy O c. have hereditary information O d. replicates O e. n product of evolution O f. moves around to find food Which of the following is true about a hypothesis? Select one: O a. A hypothesis must be correct. O b. A hypothesis must be falsifiable. O c. A hypothesis can only be made by a board-certified scientist. O d. Scientists always develop their hypothesis after performing an experiment. A crocodile needs to act fast in order to catch prey. They more nourished the crocodile, the better its chance of survival and th to reproduce. Over time, a group of crocodiles become genetically predisposed for speed. Natural selection…Help! Plants, like animals and c X m/modules/questions/qq.php?testid%3D2025&assignment_id3D44332847&strand=10179&element=86541&totalQuestions=10&ck=UTWNL4DOPY D Jamiah's youtube Sis Jamiah's grades Desmos | Beautiful, G asl- Google Search 2 3 4 5 6 Save Submit Multicellular organisms must be protected from the external environment. Because of this, cells of even the simplest multicellular organisms are arranged to form an external barrier of es 4) A) cellular tissue B) epithelial tissue. C) connective tissue. D) interstitial tissue. Cells as a System BID 1A S Cell Organization 0-10441 Hint FAX 1-877-816-0808 Read Our Blog hpFatima Ortiz - CA Biology B Credit 1 FF.pdf Llaborate Animal Diversity ESTR Background: Animals are multicellular eukaryotes from the kingdom Animalia. This kingdom is vastly diverse. It contains organisms as massive as So-foot-long bluc whales to microscopic organisms such as rotifers and dust mites that can only be seen with powerful microscopes. olle enl Chrde ikapacu pedonn Directions: Navigate to the following website: https:/bindiversityintrobio.wordpres.com kingdom-Animalia "kngian Anmalia An Ovenicw XBiodyersity, Wardrcu.cn 17 Spt 2. Me For cach of the 9 animal phyla, go into cach sub-page of the website to fill out the table. The first row has been filled in for you as an cxample. Body Plan Asymmetrical or radially symmetrical Phylum Example Species Interesting Fact Sponges are filter feeders, taking in materials from the water around them. Porifera Glass Sponge Cnideria Platyhelminhes Nematoda Annelida Mollusca Arthropoda Echinodermata Chordata lifelong0lWhatis NAD yecycleWrite a short commentary of no more than eight hundred (800) words on How has technology changed our lives in the Caribbean compared to those of people living here a century ago?ScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick FranklinDON'T CANCEL I WILL UPVOTE LETTER D please choose statements/concepts that relate to SCIENCE that begins with letter D D letter should include: The word/phrase you associate with that letter A short paragraph elaborating it definition or brief introduction of the chosen word/phraseSEE MORE QUESTIONS