Shown in the following table are several amino acid substitutions in the a and B chains of human hemoglobin. Use the genetic code table in Figure 12.7 to determine how many of them can occur as a result of a single nucleotide change. Substituted НЬ Туре НЬЈ Toronto ньЈ Оxford Normal Amino Acid Amino Acid Ala Asp (a-5) Gly Asp (a-15) Hb Gln lu (a-54) НЬ Bethesda Tyr His (B-145) Hb Sydney Val Ala (B-67) HbM Saskatoon His Tur (R-63)

Shown in the following table are several amino acid substitutions in the a and B chains of human hemoglobin. Use the genetic code table in Figure 12.7 to determine how many of them can occur as a result of a single nucleotide change. Substituted НЬ Туре НЬЈ Toronto ньЈ Оxford Normal Amino Acid Amino Acid Ala Asp (a-5) Gly Asp (a-15) Hb Gln lu (a-54) НЬ Bethesda Tyr His (B-145) Hb Sydney Val Ala (B-67) HbM Saskatoon His Tur (R-63)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 15QP

See similar textbooks

Similar questions

Which of the following mutations would most likely keep the transitions of T state to R state in hemoglobin unchanged, or similar to the transitions that occur in the native molecule? The three-letter codes for amino acids are used, and the numbers following the amino acids designate the amino acid position in the protein. By convention, the original, native amino acid is listed fırst, followed by the mutational change. Choose one: O A. Asp94→Ile94 O B. Tyr42→Phe42 O C. Asp94 Glu94 O D. Tyr42-Gly42
Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.
if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of nucleotide base pairs needed to code for B-globin
Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lys
The bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.
HbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.
Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?
Give the effect of the following changes in the protein structure of hemoglobin Replacement of analanine located at the middle of helix B with proline
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in formation of protein oligomers with the Glu 6 --> Val 6 sickle cell mutation? Does normal hemoglobin contain this same amino acid pair constituting a hydrophobic patch? Phe 85 / Leu 88; no Phe 85 / Leu 88; yes Trp 85 / Leu 88; yes Olle 85 / Leu 88; yes Pro 85 / Lys 88; no
The proximal histidine residues have been replaced by glycine residues by mutation of the cloned genes for both the α and β subunits of hemoglobin. With the tetrameric mutant hemoglobin (all subunits being mutant, α H F8 G, β H F8 G), it was found that the “proximal” coordination bonds to hemes in the mutant protein could be replaced by having the small molecule imidazole in the buffers. Oxygen binding curves for the tetrameric mutant hemoglobin were measured. A. The degree of cooperativity in oxygen binding for the mutant hemoglobin (with imidazole present) would be expected to 1) increase 2) decrease 3) not be affected) compared with the normal protein. B. Justify your answer to part A in terms of what you know about the structural basis of cooperativity in hemoglobin. C. How would the Hill coefficient for the mutant be expected to change compared with nH for normal hemoglobin, which is ~3?
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-