Suppose you want to study the transcription in vitro of one particular gene in a DNA molecule that contains several genes and promoters. Without adding specific regulatory proteins, how might you stimulate transcription from the gene of interest relative to the transcription of the other genes on your DNA template? To make all of the complexes identical, you would like to arrest all transcriptional events at the same position on the DNA template before isolating the complex. How might you do this?
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: The process of the formation of RNA from DNA is called transcription. The process of the formation…
Q: the string of A nucleotide following the inverted repeat in a rho-independent terminator were…
A: Several mechanisms of regulation transcription termination are discovered in bacterium and…
Q: The nucleus of a eukaryotic cell is much larger than a bacterium, and it contains much more DNA. As…
A: Gene transcription and its regulation in prokaryotics is much simpler. But the eukaryotic Gene…
Q: complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with…
A: PPE stands for a promoter-proximal element which is an additional promoter that contains AT-rich…
Q: You are studying how gene transcription gets started in eukaryotes. Which of the following…
A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…
Q: Compare and contrast Prokaryotic and Eukaryotic transcription. For full credit, you must describe…
A: Transcription is the process in which RNA is synthesized from the DNA. It occurs in three stages-…
Q: Why do transcriptional regulators act as dimers or heterodimers rather than monomers when binding to…
A: Genome of an organism, especially of eukaryotes, contain large number of non-coding sequences. In…
Q: Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter…
A: Introduction Promoter are the consensus sequences found either upstream or partially downstream of…
Q: EUKARYOTIC RNA POLYMERASE TRANSCRIPTION FACTORS Rather than just a sigma factor to recognize the…
A: Answer :: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to…
Q: Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT…
A: The CAAT box is popularly known as a core promoter or basal promoter or simply the Promoter. It is…
Q: A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho…
A: Transcription is the process of transcribing DNA into mRNA with the help of RNA polymerase. Rho…
Q: Suppose that a mutation in the glucocorticoid receptor does not prevent the binding of the…
A: A glucocorticoid receptor is a receptor of cytosols and other glucocorticoids. It regulates the…
Q: In response to potentially toxic substances (e.g., high levels of iron), eukaryotic cells often use…
A: Post-transcriptional modifications of pre-mRNA molecules like capping, splicing, and…
Q: 3′-->5′ Exonuclease activity allows DNA polymerase III (Pol III) to back-up and fix a mismatched…
A: Since there are multiple questions in this particular question, I'll answer the first one for you.…
Q: For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?…
A: Transcription is the mechanism by which an RNA copy of a gene sequence is produced. This clone,…
Q: Transcriptional regulators are proteins that bind to promoters (at the 5’ flanking regions of genes)…
A: Transcription is the synthesis of mRNA from DNA template with the help of RNA polymerase and many…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA -…
A: Promoters are essential components of expression vectors because they regulate RNA polymerase…
Q: Name and discuss two transcription regulatory elements that can be found in the figure. (6) 4.2.…
A: RNA polymerase is a main enzyme responsible for the the transcription of RNA by coding complementary…
Q: Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds…
A: apart from the regular looping mechanism, enhancers are also capable of 3 more mechanisms that can…
Q: You made four mutants for a promoter sequence in DNA and studied them for transcription. The results…
A: Promoter are the sequence present in the DNA. These allow the binding of transcription factor and…
Q: Let’s suppose a mutation in the glucocorticoid receptor does not prevent the binding of the…
A: Glucocorticoid receptors, which are present in the cytosol, are associated with a heat shock protein…
Q: Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the sigma…
A: The microbiology studies about both the diseases causing microbes and beneficiary microbes, about…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA -…
A: The sequence of nucleotides required for the initiation of transcription is known as the sigma…
Q: Discuss the following argument: “if the expression of every gene depends on a set of transcription…
A: The process by which a gene gets turned on in a cell to make proteins is termed as gene expression.…
Q: A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but…
A: Answer - Option A - It will prevent the transcription termination exerted by the Rho protein
Q: You wish to determine which genes are aberrantly expressed in a certain type of cancer. How would…
A: Cancer is a disease of uncontrolled gene expression. It is a proliferative disease as it can induce…
Q: Mutations in the promoter region of the B-globin gene indicate that some areas are more sensitive…
A: Transcription and Translation are two main steps of gene expression by which the genetic information…
Q: As discussed in the text, promoters were originally identified as consensus sequences upstream from…
A: The promoters are considered as the specific nucleotide sequence that is present in the upstream…
Q: Methylation of H3K9 by itself silences genes, but if H3K4 and H4K20 are also methylated, the…
A: Histones are the basic proteins that are employed in nucleosome formation during the chromatin…
Q: Bacterial DNA containing an operon encoding three enzymes is introduced into chromosomal DNA in…
A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…
Q: Gene-specific transcription factors interact with DNA to control gene expression. At which surface…
A: Transcription is the process of copying genetic information from one strand of DNA into RNA. The…
Q: Histone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: What is one function of TFIIH during transcription? a. Recruiting the TATA-box binding protein…
A: Transcription factor II Human is a crucial protein complex which have important role in…
Q: Several examples of antisense RNA regulating translation in bacterial cells have been discovered.…
A: Introduction Gene silencing is the technique by which the expression of any gene can be inhibited…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: Introduction Termination of transcription: It involves the termination of RNA chain synthesis by…
Q: Many transcriptional activators are proteins with a DNA-binding domain (DBD) and an activation…
A: Introduction Protein is the key biomolecule in the biological system, any important physiological…
Q: You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the…
A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a…
Q: Many bacterial genes with related functions are arranged in operons, sets of contiguous genes that…
A: Transcription is the first od several steps of DNA based gene expression in which a particular…
Q: Enhancers can influence the transcription of genes far away on the same chromosome. How are the…
A: The synthesis of RNA (messenger RNA) from the strand of DNA is referred to as transcription. An…
Q: The DNA-binding proteins that recognize and accurately initiate transcription at specific eukaryotic…
A: * Response elements are short sequences of DNA within a gene promoter that bind specific…
Q: a)How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10…
A:
Q: The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor…
A: JASPAR is an open-access database of curated. It is a non-redundant transcription factor (TF) which…
Q: The yeast gene SER3, whose product has a role in serine biosynthesis, is repressed during growth in…
A: The yeast cell consists of a cell wall and a plasma membrane. The cell wall is composed of mostly…
Q: The APETALA1:GUS line you were given is a transcriptional fusion. Given that APETALA1 encodes a…
A: Introduction : Transcriptional reporters is a promoter fragment from gene of interest harboring GFP.…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18…
A: Transcription is the process of creating new RNA by duplicating the DNA strand. Transcription is the…
Q: How do we know that the orientation of promoters relative to the transcription start site is…
A: Transcription is a process in which a sequence of DNA is transcribed into mRNA.
Q: Transcription is currently believed to occur in bursts, whereby increased burst frequency is…
A: Thank you for the question Answer :- When DNA to RNA transcription occurs in the form of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A cloned gene fragment contains a regulatory element that isrecognized by a regulatory transcription factor. Previousexperiments have shown that the presence of a hormone resultsin transcriptional activation by this transcription factor. To studythis effect, you conduct an electrophoretic mobility shift assayand obtain the following results: Explain the action of the hormone.Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
- The hunchback gene, a gene necessary for proper patterning of the Drosophila embryo, is translationallyregulated. The position of the coding region withinthe transcript is known. How could you determine ifthe sequences within the 5′ UTR or 3′ UTR, or both,are necessary for proper regulation of the mRNA’stranslation?Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
- You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the sysgene. If this protein is a positive regulator, which ofthe following would be true?a. Loss-of-function mutations in the gene encodingthe DNA-binding protein would cause constitutiveexpression of sys.b. Loss-of-function mutations in the gene encodingthe DNA-binding protein would result in little orno expression of sys.Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?A. Identify the mutation(s) that lead to the most loss in transcriptional activity, and discusswhether those match expectations based on the consensus sequence for the Initiator.B. Hypothesize a molecular mechanism to explain how the mutations identified in Part Aresult in loss of transcription activity.C. Identify whether any mutations cause transcription to initiate from a different positionthan wild-type, and provide a brief explanation as to why that occurs for those mutantcore promoters. THIS IS A PRIMER EXTENSION ASSAY
- In eukaryotic cells, transcription cannot begin until(A) the two DNA strands have completely separated and exposed the promoter.(B) several transcription factors have bound to thepromoterThe following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?How does the 4 feature of transcription factors namely the structural motifs of DNA binding protein, activation domains, multiple transcription factors and enhancers help in the design of a building block tool. U can use the SrY gene as ur building block tool. Pls explain in details using those features of the transcription factors. In 400 words