The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…
A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…
Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…
A: The introns are the non-coding parts of the premature mRNA that must be removed by…
Q: (a) Assuming that transcription starts with the first C in the template strand, and continues to the…
A: The DNA carries all the genetic information. It is expressed in the form of proteins which are made…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.
Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…
Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…
A: Transcription is process through which DNA is converted into mRNA.
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: 1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by…
A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: According to Bartleby guidelines only the first question in case of multiple questions have to be…
Q: (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the…
A: Proteins are the biological polymers of amino acids. They are formed by peptide bonds by polypeptide…
Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…
A: Given: DNA sequence
Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…
A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…
Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…
A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…
A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: Splicing The removal of introns (non coding part of gene) from pre mature RNA.
Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…
A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…
Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…
A:
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…
Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons. How…
A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…
Q: What would be the effect on reading frame and gene function if: Two bases were inserted into the…
A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…
Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…
A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…
Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…
A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…
Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…
A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately…
A: The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub- parts for…
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…
Q: Which of the following is the definition of a gene? A. RNA that delivers amino acids to a ribosome…
A: Genetics is a science of the study of genes. It involves the identification of specific genes for…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and…
A: DNA is the genetic material and is present in the nucleus of the eukaryotic cells.
Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…
A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…
Q: How might a single base substitution in the sequence of a gene affect the amino acid sequence of a…
A:
Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…
A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…
Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…
Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…
A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…
Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…
A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
- The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
- Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.