The following statements best describes the RNA structure EXCEPT some eukaryotic RNAS stay in the nucleus to help in post transcriptional modification it is usually single stranded (c) there are three predominant forms for protein synthesis the repeating units are deoxyribonucleotides

The following statements best describes the RNA structure EXCEPT some eukaryotic RNAS stay in the nucleus to help in post transcriptional modification it is usually single stranded (c) there are three predominant forms for protein synthesis the repeating units are deoxyribonucleotides

Name: The following statements best describes the RNA structure EXCEPTsome
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following statements best describes the RNA structure EXCEPTsome eukaryotic RNAS stay in the nucleus to help in post transcriptional modificationit is usually single stranded(c) there are three predominant forms for protein synthesisthe repeatin

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The following statements best describes the RNA structure EXCEPT it is usually single stranded there are three predominant forms for protein synthesis the repeating units are deoxyribonucleotides some eukaryotic RNAs stay in the nucleus to help in post transcriptional modification
Which of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.
Which of the following is a feature of tRNA that is important for its function in translation? O The codon that pairs with the mRNA Covalent, intramolecular bonds that confer secondary structure O The aminoacyl bond to an amino acid O Its ability to serve as an enzyme that catalyzes peptide bond formation
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNA
All of the following are true about translation EXCEPT _____. as the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide when the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA Ribosomal subunits and a tRNA-carrying methionine converge on the start codon of an mRNA
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
All of the following statements about translation are true except: Release factors recognize stop codons and prompt-cleavage of a peptide bond. Initiation factors are involved in ribosome assembly. In prokaryotes, initiator transfer RNA (tRNAf) is attached to formylmethionine. Each messenger RNA contains a start codon and a stop codon.
Which enzyme is responsible for "charging" tRNAS with the correct amino acid? OAminoacyl-tRNA synthetase ATP synthase Ribosomes RNA polymerases O O O