The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase or term as relati replication, transcription, or translation. Replication single DNA strand is used to produce mRNA DNA polymerase amino acids added to peptide chain- Transcription Answer Bank described as semi-conservative requires tRNA ribosome Translation both DNA strands are duplicated
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Describe experimental enzyme inhibition and how it leads to a deeper understanding of enzyme…
A: Enzyme inhibition: The activation energy required for a reaction to occur is decreased by enzymes,…
Q: Provide 6 reactions that facilitate the synthesis of oxaloacetate
A: Introduction Oxaloacetic acid in the form of oxaloacetate is a metabolic intermediate in many…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: Calculate AG for this reaction under the following conditions: 37°C, pH 7, [Pyruvate] = [CO₂] = 4.0…
A: The thermodynamic function called Gibbs free energy (G), named after Josiah Willard Gibbs, best…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introducion Transcription is a process by which mRNA is produced from DNA and protein is produced…
Q: please explain how to solve this type of questions
A: Each amino acid's preference for the alpha or beta secondary structure can be estimated. The…
Q: Please explain the formula (process) used to get the Red undelived numbers, Thanks!! example each…
A: Enzyme kinetics - Enzymes are usually comprise of protein molecules which is used to catalyzed…
Q: Structure, localization and biological significance of glycogen.
A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Several problems not applicable to synthetic drugs often influence the quality of herbal drugs -…
A: Synthetic drugs are the pure form of a compound prepared and approved by testing in several trials.…
Q: What are the biochemical cycles?
A: Biochemistry is the way of understanding of different chemical reactions that occur within the…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of the…
A: By forming a DNA-protein complex with a specific DNA binding protein, DNA regulatory sequences…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are compounds which are soluble in organic solvents and insoluble in polar solvents, i.e.,…
Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…
A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the milk is composed of ~88% water and ~12%…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: 1.How many chiral center does D-Eranose have? 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Calculate protein concentration in unknown samples 1, 2, 3: Absorbance of Unknown 1 = 0.541…
A: Given that the standard BSA concentration is 1mg/mL. 10, 20, 30 ,40 and 50 µL of the standard BSA…
Q: Pathological Constituents of Urine C3. What are ketone bodies? What conditions (or diseases) lead…
A: Urine often contains water as well as contaminants such as urea, uric acid, ions, and creatinine.…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: discuss the G-protein coupled receptors structure and overview of G-protein dependent signaling…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Arrange the following in the order they appear in electron transport. a. FAD, coenzyme Q, cytochrome…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: A substance called glyceraldehyde occurs naturally in all living things, including people. It is a…
Q: How do ATP levels regulate glycolysis? 00 High levels of ATP enhance glycolysis ATP levels do not…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Discuss how each denatures protein.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: a) What amino acid is metabolite 1? b) What kind of reaction occurs when 1 is converted to 2? c)…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…
A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…
Q: The catalytic activity of enzymes depends on the presence of appropriate environmental conditions.…
A: Pepsin is a digestive enzyme found in the stomach. It is a type of hydrolase enzyme that help in…
Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…
A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…
Q: Biological waxes are all: A) trimesters of glycerol and three long chain saturated fatty acids. B)…
A: Introduction: Lipids are hydrophobic molecules that are composed of carbon, oxygen, and hydrogen.…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which protein is needed to lay down a segment of RNA complementary to the DNA before replication can begin? O RNA pelymerase NI O primase O helicase O DNA polymerase lII O topoisomeraseDescribe the chemical structure of DNA and its signifi canceName all the enzymes involved in DNA replication along with theirrespective function.
- A seiee hserved under a microscope, researchers observe that the DNA is able to be SE be replicated. Based on this observation, which protein involved in DNA replication is most likely mutated? To answer the question please: I) draw a scheme of DNA replication; 2) name the proteins that are required for DNA replication; 3) propose the consequences of the process.He sequence is read A DNA sequence before and after replication IS 3 from left to right. The table below shows which mRNA codons code for each type of amino acid. Second mRNA base с U A G DNA sequence before replication: TACCTAGCT UUC - Phe UCC - U UUU- Phe UCU - Ser UAU - Tyr UGU - Cys Ser UAC - Tyr UGC-Cys C UUA - Leu UCA - Ser UAA- Stop UGA - Stop A Leu UCG - Ser UAG - Stop UGG- Trp G Pro CAU - His CGU - Arg U - Pro CAC- His CGC - Arg C DNA sequence after replication: TACCTCGCT UUG Leu CCU CUU CUC Leu CCC CUA- Leu CCA- Pro CAA Gln | CGA- Arg A - Pro CAG - Gln CGG- Arg G AGU- Ser U AGC - Ser C CUG Leu CCG AUU AUC Lys AGA- Arg AGG- Ile ACU Thr AAU - Asn Ile ACC - Thr AAC - Asn ACA - Thr| AAA - ACG - Thr AAG - Lys GCU - Ala GCC - Ala Arg A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes the result of the mutation when the corresponding mRNA sequence is translated? GAU- Asp AUA Ile AUG- Met GUU - Val GUC - Val Val Val GCG - Ala GAC - Asp…Enter the corresponding section of mRNA produced feom the following sections of a DNA template strand: G C G A A T G A C C A T
- Which of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, butDescribe the steps of DNA replication. (keep it short plz)