The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an underlined mutation. Original mRNA AUG UCG AAU UGU CGU UAA Amino acids Met Ser Asn Cys Arg Stop MRNA mutant AUG UCC AAU UGU CGU UAA Amino acids Met Ser Asn Cys Arg Stop What type of mutation is represented in the mutant? nonsense O silent sense missense
Q: Which of the following applies to quaternary structure? O a. It has two alpha and two beta subunits…
A: Proteins structures are made by condensation of amino acids forming peptide bonds. Classification…
Q: Assuming that 32 million histone octamers arerequired to package the human genome, how many his-tone…
A: Introduction :- Chromosome proteins are a type of protein. Histones bind to DNA, aid in the…
Q: QUESTION 4 Select all the statements that correctly describe triglycerides. Sources: textbook…
A: Answer
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: ANSWER;- A) cadherin- desmosomes B) cellulose - cell wall C) collagen - basal lamina D) connexons -…
Q: Match each vitamin with the correct deficiency or toxicity condition or symptoms Vitamin C [Choose]…
A:
Q: racteristics mparison of Major Taxa Fungi Bacteria Archaeans Protists Plants Animals None of the…
A: The given diagram shows the different characteristics of taxonomical classification of different…
Q: What are the physical and physiological differences between an artery and a vein?
A: Artery- The blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body.…
Q: During which process of photosynthesis is water split and oxygen released? Calvin Cycle photosystem…
A: Photosynthesis is the process of conversion of CO2 and water molecule in sugars and oxygen.
Q: QUESTION 1 Picture 1 Pic. 1: Name one genus/species from the fungi we studied that might be growing…
A: Fungi are Eukaryotic organism that can be one cell or many celled . Fungi is classified into :- I…
Q: 14. Design an experiment to determine how tightly epithelial cells are connected through cell…
A: Cell adhesion is described as a process by which there is the interaction between the cells and…
Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…
A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…
Q: Ô https://blackboard.grandview.e.. A 自 D Question Completion Status: 2 points Save Answer QUESTION 5…
A: Fatty acids, that can not be synthesized by our body but they are essential for our good health.…
Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…
A:
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Given: Enzymes are the molecules that act as biocatalysts, aids biological and biochemical reactions…
Q: Why are okazaki fragments necessary on the lagging strand?
A: In a long DNA molecule, since the the two strands of DNA cannot be separated in its entire length…
Q: What is the fate of a protein with no sorting signal?
A: Introduction A protein is an extremely complex natural molecule made up of amino acid residues…
Q: How do you explain Charlotte's inability to detect a Barr body in her buccal smear? Suggest two…
A: The X chromosome is shared by both men and females. Female somatic cells do not participate in…
Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…
A: The self replicating molecules that are present in the chromosomes and carry genetic information are…
Q: What role does cholesterol play in the plasma membrane? Select the best answer. O It provides a…
A: Cholesterol's significance in bilayer and monolayer lipid membranes has piqued researchers'…
Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…
A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…
Q: When there is light, plants release oxygen. What else may plants also use oxygen in? photosynthesis…
A: Plants release oxygen from photosynthesis. Photosynthesis is a process in which green plants prepare…
Q: Below is a Figure of a Leaf Epidermis, Determine what is structure X? A.Stomata B. Stomatal…
A: Stomata are small pores present in the epidermis of leaves. They regulate the process of…
Q: What kinds of labels do school authorities apply to students? What is the outcome of those labels?
A: Labelling in schools is a very common process nowadays. This has led to the development of some…
Q: Carrying capacity is and is represented by the letter on the graph. O he maximum number of…
A: Population size The population size of an ecosystem depends upon food, shelter, area, etc.
Q: Why does repeated stimulation of the muscle (at maximum stimulus) before it has completely recovered…
A: Muscle contraction is the phenomenon of decreasing in size or shortening or compacting the muscle…
Q: The main difference between starch and cellulose is: O A) starch is made of fructose, while…
A: Starch Cellulose Uses about 200-1000 Glucose molecules to form one starch molecule. Take up 500…
Q: Explain two ways that soil can lose nutrients.
A: * The soil can lose its nutrients by soil erosion, runoff, leaching and burning of crop residues. *…
Q: Determine whether each of the following traits are the result of convergent evolution?
A: Convergent evolution is the process where distantly related organisms independently evolve from…
Q: Livestock Breed Identific - Student Notes 46. Piedmontese Size: breed Cows average between 1.200 to…
A: The Piedmontese is a breed of domestic cattle, originated in north west Italy in the region of…
Q: Name and describe in DETAIL the three steps of translation.
A: The genetic material DNA contains all the necessary information needed to sustain life, half of the…
Q: Which of the following is an explanation for independent assortment of alleles on different…
A: ANSWER;- B) In metaphase I, the alignment of 1 pair of replicated chromosomes does not affect the…
Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.
A: The term homeostasis was given by Canon (1960). It is the mechanism by which stable chemical and…
Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.
A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…
Q: Root hairs____ . a. conduct water from cortex to aboveground shoots b. increase the root’s surface…
A: Roots are the underground structures of plants.
Q: at is trinocular microscope
A: A magnifier could be a device that magnifies a picture of a little object, revealing details that…
Q: Of the circled parts, determine which is/are sclerenchyma cells 3 2
A: Sclerenchyma tissue present in plants.
Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.
A: Introduction :- Homeostasis is the tendency to maintain a stable, relatively consistent internal…
Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…
A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…
Q: Which of the following is false? a. Stems have vascular bundles, and roots have vascular cylinders.…
A: Botany, often known as plant science, plant biology, or phytology, is a discipline of biology that…
Q: Explain the total yield of ATP from aerobic respiration in three different stages of cellular…
A: The three stages of cellular respiration are - 1) Glycolysis - It is a step of breaking down 1…
Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…
A: Given: Anything that cause changes in the DNA of the cell is known as mutagens. DNA are the…
Q: Treatment of cells with a drug that blocks the function Ran-GAP would result a. the accumulation of…
A: Proteins are transported into and out of the nucleus by nuclear pore complexes, which entail a…
Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…
A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…
Q: Below is a Figure from a Shoot Tip, indicate which numbers islare meristematic cells? - 2 3
A:
Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…
A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…
Q: Explain the steps involved in translocation of sucrose.
A: Xylem and phloem are the vascular tissues present in the vascular plants.
Q: What is the difference between the heart sounds of lupp and dupp?
A: Lub and dup are cardiac sounds that can be detected with a stethoscope placed on the chest just…
Q: 17. Lariat formation is a step in which of the following: transcription post-translation…
A: Lariat formation is a step in transcription.
Step by step
Solved in 2 steps
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterThe following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
- thank youFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe following mutants are observed in a gene coded for a ribosomal protein. The mutations are highlighted: Original mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’- AUG GGC UCG ACU UUG -3’ Mutant mRNA 3: 5’- AUG GGC UCG AGC UUG -3’ Mutant mRNA 4: 5’- AUG GGC UCG AUC UUG -3’ A. Write out the protein sequence for the original protein. 1. Three letter sequence (write with one space in between, i.e. Val Leu Gly) 2. One letter sequence (write out with one space between, i.e. V L G) B. Characterize the mutants (#1-4) as silent, nonsense, or missense mutations.
- The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple