Q: which plants are more adapted for the tundra?
A: Biome: It is a collection of plants and animals which contain the same characteristic for an…
Q: explain this image for the ecoli bacteria mutation trpE
A: Introduction The trp operon is a type of operon system found in E. coli bacteria. The trp operon…
Q: If there are 24 chromosomes in a somatic cell in the Gap 1 of the cell cycle, what is the diploid…
A: The G1 phase, also known as the gap 1 phase or growth 1 phase, is the first of four cell cycle…
Q: In mice, grey coat is dominant: albino coat is recessive. A grey mouse mated several times in…
A: Understanding patterns of characteristics transmission requires knowledge of the fundamental…
Q: Fertilized, unfertilized, and mammilated coat eggs of O O Strongyloides stercoralis Necator…
A: Some parasites can also cause severe allergic reactions, such as itching, rashes, and respiratory…
Q: T = Tall t = short pollen from a tall pea plant T T eggs from a tall pea plant T TT TT t Tt Tt In…
A: ANSWER) In the given cross the Tall plant with genotype TT is crossed with the short plant of…
Q: 20. How is oxygen and carbon dioxide exchanged across a lung cell membrane? a. diffusion b. C.…
A: Diffusion is the movement of molecules from a region of higher concentration to a region of lower…
Q: Pinworm infection is often accompanied by intense pruritis. O True O False
A: Pinworm infection is also known as enterobiasis or oxyuriasis. Pinworms are white, narrow worms with…
Q: Please put these steps in the correct order.Is this for leading or lagging strand RNA nucleotides…
A: Central dogma includes events of processes in an ordered way for the synthesis of genes and proteins…
Q: 88 1 Dihybrid Crosses - Problem 1 WELL STICK WITH PEAS FOR THE FIRST PROBLEMI The allele for round…
A: A dihybrid cross is a cross that involves two characters. Genotypes - Smooth/ round - RR or Rr…
Q: I gained lots of fat, how to be lean?
A: Your capacity to lose or acquire weight is influenced by your somatotype, or body type. Ectomorphs,…
Q: typical prokaryotic cell has about 3,000 genes in its DNA, while a human cell has almost 21,000…
A: Similar genes present in two different organisms is suggestive of some common features that occur in…
Q: Which of the following is true? Question 10 options: a) A person's phenotype is a trait that…
A: Any observable trait in a person such as height, eye colour or blood type is referred to as…
Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…
A: Gene expression is the process by which a gene's information is used to create a functional gene…
Q: ple Cell Lysate Protein Concentrations
A: Sample Volume (uL): 5 Total Volume (uL): 1000 Total Dilution Factor: 200 [Total Protein] (mg/mL):…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Vertical elongated cells of the xylem (such as tracheids or vessels) are developed from a. cortex O…
A: Introduction: The elongated tracheary portions that deliver water are the xylem cells that are most…
Q: The component giving wood its stiffness in compression is a. lignin O b. extractives O c. cellulose…
A: This question explores the components that give wood its stiffness in compression. It looks at the…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: Research helps to improve our understanding of diseases and other health conditions, including their…
Q: what would happen to the action potential if the potassium channels opened before the sodium channel
A: Neurons and muscles have cells that generate an action potential in response to stimuli. These are…
Q: explain how one would determine which strand is leading and which strand is lagging in the…
A: Introduction DNA acts as a genetic material in our body. DNA is a self replicating molecule. DNA…
Q: Where does absorption of nutrients happen in the vertebrate digestive system?
A: Digestion is a process in which the conversion of complex food substances into simpler absorbable…
Q: State whether TRUE or FALSE. Explain your answer Reverse transcription occurs naturally in the…
A: Reverse transcription is mainly an event in which RNA is converted into c-DNA.This is mainly done by…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: Are monoclonal tree plantations more or less sensitive to pests and diseases? O a. more O b. less
A: Trees grow on one site for many years. This may allow a pest or disease to build up over time with…
Q: Which of the following is NOT true of photosynthesis? The light-independent ("dark") reaction makes…
A: A) light independent reaction makes glucose from CO2 and water, using energy trapped by the…
Q: If a bacterial cell is placed in a hypertonic (hyperosmotic) solution: There is no net movement of…
A: Introduction:- Bacteria are prokaryotic organisms because they do not have a well defined and…
Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…
A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…
Q: Evaluate the nutritional label of a food item, either one in the supermarket or one that you have…
A: This question will evaluate the nutritional label of a food item, specifically potato chips, and…
Q: 4) Explain why the edema of tissues does not appear if it was stated that the filtration force which…
A: Capillaries are the smallest blood vessels in the body and play a crucial role in the exchange of…
Q: Explain the steps of RNA translation into protein.
A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Macromolecule Carbohydrates Lipids Proteins Nucleic Acids Monomer Amino Acids Elements Present C,H,O…
A: Large, naturally occurring cellular components known as biological macromolecules perform a number…
Q: Explain what epigenetic theory is.
A: Greek for "epi" means "on or above," thus "epigenetic" refers to elements other than the genetic…
Q: There is a spherical neuronal soma with a radius of 35 µm and a resting membrane potential of -60 mV…
A: Neuronal soma- It is the main part of the neuron in which the dendrites come out as branches.…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: Label the 5' end and the 3' end of the future polymer and explain why this is the case 0 61810 6 CH₂…
A: In molecular biology and biochemistry, the 5' end and 3' end of a nucleic acid polymer refer to the…
Q: Independent of any possible effects of trout, estimate the reduction in frog density caused by the…
A: Answer and Explanation : Trouts are only not added to two groups: group 1 (no trout, no parasite)…
Q: You have been asked to engineer a protein (which is not an immunoglobulin) that is capable of…
A: Protein engineering is the process of deliberately modifying the structure and/or function of…
Q: what is the basis on which the microorganism are clasified ?
A: Introduction: Microorganisms are any organisms that are microscopic in size, exceedingly small, or…
Q: Suppose the progeny were crossed. Fill in the Punnett Squares below and answer the following…
A: Round green pea plant may be rrAa or rrAA and wrincled yellow plants may be RRaa or Rraa. In the…
Q: State the law of segregation. How does the law relate to meiosis?
A: We all know that Gregor Johan Mendel is known as Father of Genetics.He was the only scientist who…
Q: Describe the role of the endocrine pancreas Describe the location and function of the pineal gland,…
A: The endocrine system is a complex network of glands and organs that secrete hormones into the…
Q: Directions: Use the Punnett Squares from the previous problems to answer these follow up questions.…
A: Note: “Since you have asked multiple questions, we will solve the first question for you. If you…
Q: In the palpation method of indirect blood pressure measurement, only diastolic pressure can be…
A: In order to measure frequent blood pressure, for example, in wards where patients are kept palpatory…
Q: Stains are used because O they bind evenly to all str they reduce contrast and make it easier to see…
A: Staining is a procedure in microscopy where a specimen to be viewed under the microscope is…
Q: What might occur in a cell lacking lysosomes? Select all that apply. Check All That Apply The pH of…
A: The word lysosome means lyso - lytic (digestive) and soma - body. Hence helps in digestion.…
Q: Are the impacts of the biotic and abiotic factors of the Spotted Lanternfly short or long term or…
A: The spotted lanternfly (Lycorma delicatula), also known as lanternmoth, is neither a fly nor a moth.…
Q: 1. In pea plants, round seeds (R) are dominant to wrinkled seeds (r). A homozygous dominant plant…
A: The genotypes of a specific cross or breeding experiment are predicted using the Punnett square, a…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: The experiments are conducted for any research studies. The research studies can be of various…
Q: Muscular Development Training Enhance stabilization endurance while increasing prime mover strength.…
A: OPT means optimum performance training model. It has 5 phases. The phases (1 to 5)of OPT model are…
Step by step
Solved in 2 steps
- Compare the Venn diagram of sexual reproduction and asexual reproduction in plants. Where in the diagram would you add identical to parent? A) A B) B C) C D) D use photo Not GradedList the two types of haploid cells that are fertilized in a plant's double fertilization. What do they form in the seed? And how could a forest fire be beneficial to a seed.During polyembryony, if one embryo is formed from synergids and the other from nucellus, state the one that is haploid and the one that is diploid.
- Explain the process of germination.Compare the Venn diagram of sexual reproduction and asexual reproduction in plants. Where in the diagram would you add identical to parent A)a B)b C)c D)dCompare the Venn diagram of sexual reproduction and asexual reproduction in plants. Where in the diagram would you add identical to parent? A) A B) B C) C D) D
- A pollen of maize with nuclei labeled P, Q and R fertilized an embryo sac with nuclei labeled S, T, U, V, W, X, Y and Z as shown here. R V Y Synergids U W P Tube nucleus Antipodals Which of the following combinations could be found in the embryo? i) PQR, ii) QRY, iii) VWQ, iv) RY Which of the above combinations could be found in the aleurone layer of the seed? Which of the above combinations could be found in the germinating pollen tube?With the whitefish blastual cell during interphase, prophase, metaphase, anaphase, telophase and cytokinesis when is cell furrow, chromosomes, duplicated chromosomes,mmitotic spindle and nucles present and visable?Draw a simple diagram illustrating alternation of generations in plants, including the sporophyte and gametophyte generations, spores, gametes (eggs and sperm), meiosis, and fertilization. Be sure to indicate whether each generation or kind of cell is haploid or diploid.