Q: A) Examine the model depicting the relationship between photosynthesis and cellular respiration.…
A: Introduction: In order to provide plants with nutrients and all the minerals they need,…
Q: Which is a factor that can determine a person's skin color? Genetic O Environmental O Physiological…
A: Although there are several elements that affect skin colour, melanin is by far the most significant.…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: Mention and explain at least one reason why you might obtain growth of bacteria on EMB that was…
A: EMB is selective dye used for isolation of gram negative bacterial ( E.coli and coliforms) EMB…
Q: Multiple Choice Question: Which of the following sensory structures of insects can detect air- or…
A: Insects are among the most significant animals on the planet. They participate significantly in…
Q: How early man could easily perceive the difference between inanimate matter and living organisms
A: Traditionally, when we try to define life, we look for specific traits that living things exhibit.…
Q: 2) how do our nephrons deal with Coke. you must mention each part of the nephron any filtration,…
A: The kidneys are a pair of bean-shaped organs on either side of our spine, below our ribs and behind…
Q: If there is a tiny island in the ocean, that is located 3,000 kilometers away from any other island…
A: Islands are isolated land masses surrounded by water. They are found all throughout the planet, and…
Q: Which of the following refers to an increase in mutations due to defects in proteins needed to…
A: DNA stands for deoxyribonucleic acid can carry genetic information. It is a self replicating…
Q: Glucose Oxidase – Triglyceride – Total cholesterol - HIgh density lipid – 5. What are some…
A: 1. Glucose oxidase test- used for the determination of free glucose in body fluids. 2. Triglycerides…
Q: what is osmosis
A: Introduction: The cytoplasm of the cell and the extracellular spaces are separated by the plasma…
Q: 2) In class we set up the two-compartment model shown below. Assuming we wanted to model intravenous…
A: By separating the single compartment into two distinct containers known as the core and peripheral…
Q: Diatoms are protists that have complex glassy structures in their cell walls. These structures form…
A: As per the guidelines, we are supposed to answer only one question. Since you have posted multiple…
Q: Cellular respiration takes place in mitochondria, They are like power houses of cells. They are…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: If proteases such as pepsin and trypsin digest protein, why do not they digest the stomach and small…
A: Break down of carbohydrate starts in buccal cavity by salivary amylase. first digestion of protein…
Q: 1. What are the characterisitics of a good diluent in a quantitative bacteriology? List these…
A: The principles of serial dilution and the procedure for applying them to ascertain the number of…
Q: Using the Kirby-Bauer method, how could you determine if a bacterial pathogen was beginning to…
A: Kirby Baeur diffision method is a test to determine the sensitivity or resistance of various…
Q: Microorganism growth in complex natural environments such as soils and waters can be utilized to…
A: Introduction A living item that must be seen under a microscope to be recognised as a microbe. Only…
Q: Develop suggestions for maintaining biodiversity (10 suggestions)
A: Biodiversity by term itself defines as a varieties in the living organisms ie a large diversity from…
Q: What are the key anatomical and physiological changes that occur in the renal system of an infant at…
A: Renal system It refers to the organ system that produces urine in the kidneys and transports it to…
Q: Why are humans GMOs (genetically modified organisms)? our genome contains genes that do not code…
A: Genetically modified organisms are the organisms whose genetic material is modified with the help of…
Q: Xanthoproteic test is used to detect amino acids containing an aromatic nucleus in a protein…
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: What is the Posner task? Describe its purpose and setup (materials, conditions, etc.). What do its…
A: Posner task Michael Posner postulated this task. It refers to the neuropsychological test frequently…
Q: how do unicellular differ from single cell multicellular organisms differ
A: Organisms are categorized into different types such as I) on the basis of nuclear membrane/nucleus…
Q: It contains digestive enzymes and plays an important role in dissolving large food molecules, worn…
A: Cell organelles are membrane bound structures. Examples are nucleus, peroxisome etc.
Q: Discuss the human life cycle and the purpose of meiosis.
A: The family Hominidae and the genus Homo include the culture species known as humans. Humans resemble…
Q: The contents of a plaque may not always contain a clonal population of phage if: a. Identical…
A: Plaque:- phage infected bacterium usually burst and releases a number of daughter phages which…
Q: what organ system is the intestines. a part of ?
A: Introduction :- The intestine is a muscular tube that runs from the bottom end of your stomach to…
Q: Sexual reproduction involves crossing-over to mix up genes. Is this a good thing or a bad thing? In…
A: Sexual reproduction involve fusion of male and female gamete containing "n" number of chromosomes to…
Q: Chemical reaction Produces ATP in all life forms Photosynthesis Chloroplast into Solar energy stored…
A: Photosynthesis is a process by which autotrophs convert light energy into chemical energy, which is…
Q: How does the intestines Form supports its Function?
A: Introduction :- The small intestine is the longest portion of the gastrointestinal tract, which is…
Q: how did the K-Pg (aka Cretaceous–Paleogene) mass extinction gave new ecological opportunities to…
A: The K-Pg mass extinction, also known as the Cretaceous-Paleogene extinction or Cretaceous-Tertiary…
Q: what of the following is more likely to speed up the loss of telomeric repeats? a.Tetreplex DNA…
A: Since DNA bases are mainly planar and moderately hydrophobic, they tend to stack parallel to one…
Q: How might the environment influence whether a fungus reproduces sexually or asexually?
A: Fungi can reproduce sexually or asexually and the choice depends on the presence of environmental…
Q: endocytosis pinocytosis symbiosis exocytosis keratosis A macrophage is engulfing bacteria through…
A: Introduction :- Macrophages are immune cells that reside or are infiltrated inside tissues and are…
Q: Calculate N+1 for this non-continuously reproducing population of weird bugs that live on a planet…
A: Given information It is a non-continuously reproducing population. No= 1000 Ro (reproductive rate)=…
Q: 성
A: Division Chlorophyta Class Phaeophyceae Order Fucales Family Sargassaceae Genus Turbinaria…
Q: Find an enzyme that is used by humans for some industrial or useful process (apart from its original…
A: Enzymes are proteinaceous substances that work as a role of catalysts by boosting the speed of a…
Q: If an intact cell is incubated with an enzyme that digests proteins so that all the (parts of)…
A: Lipid molecule has a structure with hydrophilic heads that connect with water and nonpolar tails…
Q: Discuss the permeability of the phospholipid bilayer to the molecules and ions listed below. Is the…
A: The phospholipid bilayer from the plasma membrane or any biological membrane in a cell. The plasma…
Q: Create a Venn diagram comparing and contrasting the anatomy and physiology of the respiratory system…
A: Introduction: Respiratory system is the network of organs and tissues that help us to breath. It…
Q: A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no…
A:
Q: In detail describe cyclic and non cyclic photophosphorylation, include all the steps
A: Photosynthesis is a metabolic process in which glucose and oxygen is synthesised from the…
Q: Compare and contrast the origins and functions of miRNA and siRNA
A: All living cells contain ribonucleic acid, a nucleic acid with properties comparable to those of…
Q: Which of the following is NOT found in heterochromatin? O A. Centromeres OB. Most of the Y…
A: Introduction Heterochromatin, often known as condensed DNA or densely packed DNA, has several…
Q: Of what importance are spore-forming bacteria in the food industry?
A: Food industry is the fastest growing industry nowadays. This industry have explored a lot of…
Q: Frekles are inherited as an autosomal dominant trait. Red hair is inherited as an autosomal…
A: Autosomal dominant shows inheritance when only one of the two alleles is intact dominant state and…
Q: Discuss the Medico-legal case report and custody of the MLC records
A: Medico-legal case reports are made by medical professionals who is taken as a expert witness in a…
Q: Problem 2: The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the…
A: * If the trait is dominant, then one of the parents will have the trait. Dominant traits usually not…
Q: Physician Edward H. Clarke published a treatise opposing higher education for women (Clarke, 1873).…
A: Dr. Edward H. Clarke's in 1873 had to face severe negative reactions from their opponents when he…
Step by step
Solved in 2 steps
- mapping gene The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of Drosophila melanogaster. All of these are recessive traits. They map in the order rb, ct, t with 12.5 map units between rb and ct and 7.5 map units between ct and t. Suppose you cross a cut wing male with a homozygous female that is both tan and has ruby eyes. What will the F1 females look like? Draw map of the section of the X chromosomes that has these 3 genes for the F1 females Assume you testcross your F1 females. What progeny classes would you expect? ii. Give approximate numbers for each class based on a total of 2000 progeny. Assuming the i=1 and there are no double crossovers. Assuming the i=0 and there are the expected number of double crossovers.Please keep it short. Don't add a lot of information, thanks! - Explain why it is important that meiosis converts diploid cells to haploid. Then briefly explain how meiosis does that, makes a diploid cell haploid.Equalizing the Expression of X Chromosome Genes in Males and Females Individuals with an XXY genotype are sterile males. If one X is inactivated early in embryogenesis, the genotype of the individual effectively becomes XY. Why will this individual not develop as a normal male?
- Considering the following chromosome which is represented as a series of genes on each arm separated by the centromere. Describe the type of mutation required to produce each of the mutant chromosomes below. ABCDEFG*HIJKLMNThe nuclear DNA content of a single sperm cell in Drosophila melanogasteris approximately 0.18 pg. What would be the expected nuclear DNA content of a primary spermatocyte in Drosophila? What would be the expected nuclear DNA content of a somatic cell (non-sex cell) in the G1 phase? What would be the expected nuclear DNA content of a somatic cell at metaphase?Deletion mapping: In your diploid model organism, one copy of the chromosome has all normal, dominant alleles of these genes. It is P Q R STU V (not necessarily in that order). But the other copy of the chromosome has all recessive alleles, p q r stu v. You find various deletions in which chunks of the "dominant chromosome" are missing, and so there are recessive phenotypes as shown: Phenotype -- recessive for genes... T, Q, and U R, V, and S T and U S and V Q, P, and R R and S First deletion Second deletion Third deletion Fourth deletion Fifth deletion Sixth deletion Seventh deletion T and Q Figure out the order of the genes. Show some kind of work.
- Assuming sexual reproduction and that no mutations have occurred. Please draw one possible genotype for offspring of these parents including two chromosomes with 3 alleles each.. A mature female wolf, with 78 diploid chromosomes in each somatic cell, produces haploid oocytes (egg cells) containing how many chromosomes per cell? 1 sex-determining chromosome (Y) and 38 autosomes 2 sex-determining chromosomes (XX) and 76 autosomes 1 sex-determining chromosome (X) and 39 autosomes 2 sex-determining chromosomes (XY) and 76 autosomes 1 sex-determining chromosome (X) and 38 autosomesPlease help me im so confused. a. Which is the homogametic sex in humans?ii. the heterogametic sex in humans? b.) Which is the homogametic sex in these moths?ii.) the heterogametic sex in these moths? Support your answers in part c by analyzing the two crosses shown above. PLEASEDEFINE YOUR SYMBOLS and show your work clearly.
- In mice, 2n = 40. If a mouse cell divides by mitosis, it will produce two daughter cells that each have ________ chromosomes. If a mouse cell divides by meiosis, it will produce four daughter cells that each have ________ chromosomes. Type the appropriate number to fill in each blank (e.g., 40).Need help with three question. Multiple choise. 1.) How is the outcome of meiosis different from the outcome of mitosis? a.) The daughter cells produced in mitosis are genetically different from the parent cells, but have the same number of chromosomes, while these are genetically similar in case of meiosis and have fewer chromosomes. b.) The daughter cells produced in mitosis are genetically similar to the parent cells and have the same number of chromosomes, while these are genetically different in meiosis and have half the number of chromosomes. c.) The daughter cells produced in both cases are genetically similar to the parent cells, but in meiosis, there are fewer chromosomes. d.) The daughter cells produced in both cases are genetically different, but in mitosis, there are fewwer chromosomes in daughter cells. 2.) What would be the effect on the number of chromosomes in gametes due to non-disjunction? a.) The chromosome number of the gametes remains the same as the parent…a. Manually, using a pencil, draw a cell in anaphase II from an organism in which 2n = 2 and each chromosome is metacentric. b. Given that each G1 nucleus from this organism contains 16 picograms of DNA, how many picograms of chromosomal DNA would you expect in the cell shown here?