What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with 200 residues after mRNA synthesis, starting from amino acids? Assume that the hydrolysis of PP; is equivalent to the hydrolysis of ATP for this calculation. number of ATP molecules: number of GTP molecules: 400 800 Incorrect
Q: Calculate the mass of invertase (in mg) and concentration of invertase (in mM) contained in a…
A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…
A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: catabolic pathway - draw the complete electron transport chain for myristate
A: Myristate is 14 carbon saturated fatty acid molecule (molecular formula of CH3(CH2)12COOH), a…
Q: Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are compounds which are soluble in organic solvents and insoluble in polar solvents, i.e.,…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: Catabolism - draw the complete citric acid cylcle for myristate
A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: 2. Enzyme-catalyzed reactions. Answer the following with true or false. If false, explain why. (a)…
A: Enzyme is a biological catalyst, protein in nature which can increase the chemical reaction without…
Q: The expresion ytou have like [deprotonate][protonate]. Are they multiplying or dividing? Is not…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have…
A: Introduction pUC19 is plasmid vector. Plasmid is a cloning vehicle used in recombinant DNA…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…
A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…
Q: How do ATP levels regulate glycolysis? 00 High levels of ATP enhance glycolysis ATP levels do not…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: Which of the following statements is correct regarding the structures below? CHO CHO H-OH ОН H-OH -н…
A: Monosaccharides are the simplest carbohydrates. Based on the functional groups, they are classified…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: precipitation until a final salt concentration of 70% was obtained. Determine the amount (in g) of…
A: Ammonium sulphate is the commonly used salt for protein precipitation and extraction. Under high…
Q: How many ADP molecules are phosphorylated as electrons of cytosolic NADH enter the mitochondria via…
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: How many calories are in 7101 J? (1 cal = 4.184 J)
A: Calories and joules are the units of energy . Energy is required by the body to perform functions.…
Q: Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written…
A: Isoelectric point is the pH at which the positive and negative charges are equal, i.e., the net…
Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…
A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to tetrahydrofolate by…
Q: Which electrolyte is most effected by hemolysis?
A: Hemolysis is the process of breakage of red blood cells. Hemolysis can be occurred due to viral and…
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: true/false: The cofactor ATP is essential in all transamination reactions.
A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: how to make 100ml of TBST buffer from 1X TBS (tris buffered saline solution) and 0.1% tween-20
A: X refers to fold concentration of a sample. It means the number of times the standard or stock is…
Q: After the first step in the metabolism of amino acids, which of the following statements are true?…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: A biotech company sells a "reporter assay kit" for researchers to easily find small molecules that…
A: The glucocorticoid receptor is a type 1 hormone receptor. The receptor dissociates from the chaperon…
Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…
A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: Please answer the following two questions: 1. Biochemistry and function of chylomicrons 2. The…
A: Chylomicrons are lipoproteins synthesized in the intestine. Lipoproteins are compound lipids…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a 200- residue protein, starting from amino acids? Assume that the hydrolysis of PP i is equivalent to the hydrolysis of ATP for this calculation.On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms can be used once, more than once, or not at all. Submit dCTP GMP AMP GTP dTTP activation inhibition dGTP My Answers Give Up UTP + Gln + ATP → CTP + Glu+ ADP + P₁. Cofactor: dCMP + H₂O →→→→DUMP + NH3. Cofactor: CDP+ [2H] → dCDP+ H₂O. Cofactor: Effect: Effect: Effect: Reset Help
- Chart is Given for you: Below is a chart of values for actual enzymes. Enzyme Km (M) kcat (1/s)Chymotrypsin 1.5 × 10^−2 0.14Pepsin 3.0 × 10^−4 0.5Tyrosyl-tRNA synthetase 9.0 × 10^−4 7.6Ribonuclease 7.9 × 10^−3 7.9 × 10^2Carbonic anhydrase 2.6 × 10^−2 4.0 × 10^5Fumarase 5.0 × 10^−6 8.0 × 10^2 Assume the enzyme concentration is equal across all samples (and is equal to 1). (Answer a and b only)a. Which enzyme will have the highest V0 at very high substrate concentrations? (1 M). Why? b. Which will have the highest V0 at very low substrate concentrations (5.0 × 10^−12). Why?Which of the following statements are true? Electrostatic interactions are the dominant forces in protein molecular recognition. When two proteins form a complex there is an unfavorable loss of rotational-translational entropy. Protein-protein interfaces are most often dry. The exclusion of water results in an unfavorable loss in rotational-translational entropy. The free energy change associated with the formation of an enzyme-substrate complex almost always results in an unfavorable reduction in conformational entropy of the proteins. Burial of an uncompensated positive charge inside proteins is usually unfavorable. So-called van der Waals’ interactions are essentially electrostatic in origin. Steric complementarity of the two partners forming a complex is essential to achieve optimal free energy of binding. Structural models of proteins obtained from low temperature crystallography are excellent descriptions of all biochemically relevant aspects of their function.Many blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?
- During SDS-PAGE, glycoproteins migrate as relatively diffuse bands, whereas nonglycosylated proteins typically migrate as narrow, well-defined bands. Explain the reason for this difference in electrophoretic behavior.Equilibrium constants are always dependent upon temperature. In determining equilibrium constants for biochemical reactions the equilibrium constant also depends upon ion concentration and proton concentration. Write down an equation in differential form that describe the dependence of an equilibrium constant K for a protein binding to DNA, where the equilibrium constant, K is a function of Temperature, [NaCI], and [H*], i.e. dK(T, [NaCl], [H*]).Like ribonuclease A, lysozyme from T4 phage is a model enzyme for understanding the energetics and pathways of protein folding. Unlike ribonuclease A, T4 lysozyme does not contain any disulfide bonds. A number of studies have quantified the thermodynamic contributions individual amino acid residues and their interactions make to lysozyme folding. An ion pair between an Asp residue and a His residue in lysozyme contributes 13-21 kJ/mol of favorable folding energy at pH 6.0. However, this ion pair contributes much less to lysozyme folding at either pH 2.0 or pH 10.0. Why does the Asp-His ion pair contribute more energy at pH 6.0 than at low or high pH? At pH 10.0, Asp is protonated and His may be deprotonated. At pH 6.0, Asp is protonated and His may be deprotonated. At pH 2.0, Asp and His are both deprotonated. At pH 10.0, Asp and His are both protonated. ● At pH 6.0, Asp is deprotonated and His may be protonated.
- A Leu →Ala mutation at a site buried in the core of the enzyme lysozymeis found to be destabilizing. Explain the observed effect of this mutationon lysozyme stability by predicting how enthalpy (ΔH°), conformationalentropy (ΔS°peptide), and the hydrophobic effect (ΔS°solvent) are expected to change for the mutant compared to wild-type lysozyme. Explain how ΔG°for unfolding is affected by your predicted changes in enthalpy or entropy.Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the underlying rationale for the regulatory effects exerted on ribonucleotide reductase by ATP, dATP, dTTP, and dGTP.Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11 12 13 NH2- G C G N V T H N Q C V L S -COOH If expressed in a eukaryotic cell (please mark your answer in the blank space): Position(s) ___ could be N-glycosylated Position(s) ___ could be modified with myristic acid and the bond formed would be a ______________ Position(s) ______and _____ could be modified with palmiti c acid and the bond formed would be a ______________ Positio n(s) ________ could be a segment of a lipid-linked protein with a farnesyl anchor and the bond formed would be a ______________ Position(s) ________ could be a segment of an O-glycosylated protein Position(s) ________ could be modified with a glycosylphosphatidylinositol (GPI) anchor Position(s) ________ could be phosphorylated