What molecule/feature ensures that the correct amino acid is added with reading of a specific codon during translation? the poly (A) tail of a properly modified mRNA the twisting number of a properly supercoiled DNA the methyl-guanosine cap of a properly modified mRNA the anticodon of a properly formed aminoacyl tRNA
Q: 1) Match the nucleotide pictures to their names. A) Cytosine B) Guanine C) Thymine D) Adenine
A: An biological molecule known as a nucleotide has the fundamental building blocks of a nitrogenous…
Q: Complete the following questions for your gram negative rod unknown organism (a) What test did you…
A: The gram-negative rod group is a diverse and extensive category of bacteria characterized by their…
Q: In humans, hemophilia is an X-linked recessive condition characterized by the inability of blood to…
A: Genotype is the genetic constitution of an organism for any character and the phenotype is the…
Q: The trp operon in E. coli is a negative repressible operon. This implies that... a. The trp…
A: The correct answer is:c. The trp operon makes use of a repressor and can be turned "on" (i.e., is…
Q: Integrins are important in cell crawling because they anchor the leading edge of the cell to the…
A: The cytoskeleton is the web of fibres that makes up eukaryotic, prokaryotic, and archaeal cells. A…
Q: Tapeworms infect which organ system? O Integumentary O None of the listed answers are correct. O…
A: Gastrointestinal infections are illnesses that involve the gastrointestinal tract, which includes…
Q: Continental drift has isolated breeding populations, affecting patterns of evolution in organisms,…
A: According to the geologists, the continents moved over time. It is a hypothesis that the continents…
Q: If an mRNA has the sequence 5'--AUGGUGUUA--3' what is the sequence of the coding DNA strand? Please…
A: To understand these concepts the Central dogma is very important, after that the pairing rule.
Q: #1 Structure "B" in the diagram above is... Select one: COA a sugar group (deoxyricose) OB. a…
A: A polymer made of two chains of polynucleotide wrapped around one another to create a double helix…
Q: Select all that apply: Adaptive immunity includes which line(s) of defense? Third O Second O First
A: The immune system refers to the various organs, molecules, and processes that take place in our body…
Q: I need help labeling these
A: The word Gymnosperm means "naked seed". Thus, Gymnosperms are plants that are flowerless and produce…
Q: What exactly is the distinction between the temporal features of the human vision system and the…
A: The intricate biological and neurological process through which people detect and comprehend visual…
Q: elect one: DA. A & B Which structures labelled in the diagram above are held together by hydrogen…
A: A polymer made of two chains of polynucleotide wrapped around one another to create a double helix…
Q: Neuroactive drugs, such as the antidepressant fluoxetine, function by affecting the metabolism of…
A: Fluoxetine is a selective serotonin reuptake inhibitor (SSRI) antidepressant.
Q: charadrius melodus Common and scientific name of species ♦ Reasons for being placed on…
A: Scientific name: Charadrius melodus Common name: Piping ploverThey are small, sand colored birds…
Q: Give typing answer with explanation and conclusion
A: It is very important to ensure blood not infected for the safety of the patients.
Q: Give typing answer with explanation and conclusion
A: The theory behind the fate of pyruvate after glycolysis lies in the two main pathways that can…
Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…
A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…
Q: b. Which of the following statements is not true? O Microarrays are used to determine gene…
A: The processes that regulate how genes are expressed in cells are referred to as gene regulation. It…
Q: Art-Labeling Activity: Organization of the parasympathetic nervous system Drag the appropriate…
A: The body's communication system, the nervous system, is a complicated web of cells and tissues. It…
Q: Use the picture below of the Rhizopus fungi and draw a sketch of what you observe. Be sure to also…
A: Rhizopus is a species of saprophytic fungus that grows on various dead and the decaying organic…
Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…
A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…
Q: 1. Pigment in mouse fur is only produced when the C allele is present. Individuals of the ce…
A: a. AaBbCc x AaBbCcThe parents have the genotypes AaBbCc and AaBbCc. When determining gametes,…
Q: https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-cloning-tutorial/a/overview-d…
A: Genetic cloning techniques used in the lab and natural genetic recombination processes share some…
Q: What is the most likely mode of inheritance for myopia? Select one: OA X-linked recessive OB.…
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: Use the Diagram below to help you match the terms below that have a bullet point next to them with…
A: Flowers are the reproductive part of the plant. They are made up of many components such as petals,…
Q: What pH value listed is the most reasonable for a yogurt sample? 04 8 10 01
A: A common dairy product called yoghurt is created by fermenting milk with live bacterial cultures. It…
Q: The secreted component of digestion that is primarily responsible for the physical disruption…
A: Digestion is a complex process that involves breaking down food into smaller, more absorbable…
Q: Read the following passage, filling in the blanks with the appropriate words listed below. Drag…
A: Bacterial cell walls play a crucial role in providing structural support and protection for…
Q: Which chromatids result from a single crossover in region II M m K k O MKn and mkN Mkn and MKN MKn…
A: A single crossover, also known as homologous recombination, is a fundamental genetic event that…
Q: If the ratio (A + G)/(T+ C) in one strand of DNA is 0.3, what is the same ratio in the complementary…
A: There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or RNA. Both…
Q: Question 4 Enzymes work in pathways where the product of one enzymatic reaction becomes the…
A: Enzymes are biocatalysts that perform specific biochemical reaction by converting the substrate into…
Q: Which two plants with psychoactive properties were known to be used for medicinal purposes in…
A: Ancient Egypt, with its rich and mystical history, was no stranger to the use of plants for…
Q: Give typing answer with explanation and conclusion
A: The theory behind specimen contamination is based on the fundamental principles of laboratory…
Q: Purkinje fibers are the autorhythmic cells that transfer depolarization current directly to the…
A: The cardiovascular system is also called the blood vascular or circulatory system, consists of a…
Q: Which of the following statements is not true? O Mutations are only passed down if the mutation…
A: A mutation is a permanent change in an organism's genome's DNA sequence. It can be a single…
Q: list the physical traits that set us apart from all the other members of the genus_Homo
A: The genus Homo is a group of hominins that includes modern humans, Homo sapiens, and their extinct…
Q: 1. There are two different variations at STR locus THO1. Where did these variations come from? b)…
A: The variations at STR locus THO1 come from the inheritance of alleles from the individual's parents.…
Q: 8 A 100% 1 Normal text 2 3 Arial $ 4 11 + 5 MacBook Pro : Question 1: Compare the process of…
A: Photosynthesis is the process by which green plants, algae, and some bacteria convert sunlight into…
Q: concentration through a transport protein in Group of answer choices simple diffusion. pinocytosis.…
A: Cellular transport is a basic process that permits molecules to travel across cell membranes,…
Q: In a bacterial cell with the genotype I-: P+: O+: Z+: Y+: A+, which of the following expression…
A: The lac operon in bacterial cells plays a pivotal role in the regulation of lactose metabolism.…
Q: The phrases or terms below describe different fundamental processes of nucleic acids. Sort each…
A: The process of protein synthesis involves three main stages: replication, transcription, and…
Q: See Hi Which one of the following choices correctly orders the molecules according to their ability…
A: The extracellular space or extracellular environment is separated from the interior of the cell…
Q: The Life Cycle of the Horse Embryo Process 2 Zygote Process Gametes Process 3 Reproductive organs…
A: The life cycle of a horse, like many other sexually reproducing organisms, involves a series of…
Q: Uncoupling proteins act to ______ in Bioenergetics Group of answer choices Lower the energy of…
A: The inner mitochondrial membrane contains a class of proteins known as uncoupling proteins.…
Q: Irregular hormone production
A: Human Brain: It is a complex and highly organized organ which controls various functions and…
Q: example of Period prevalance Point prevalence Mortality rate
A: Flu is an infectious viral disease which is easily spread by contact. If a person is affected with…
Q: how would the above be presented in a pedigree diagram
A: In order to address this question, we will construct a four-generation pedigree based on the given…
Q: The Bohr Effect The First Law of Thermodynamics The Second Law of Thermodynamics The Q 10 Effect
A: Enzymes are biological molecules that serve as catalysts for a variety of biochemical events that…
Q: Which of the following statements is correct about DNA replication? Select one: a. The lagging…
A: DNA Replication is a process which occurs in the nucleus, in case of Eukaryotic cells. During the…
Pls help ASAP
Step by step
Solved in 3 steps
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GDuring translation elongation cycle, which of the following step(s) is/are repeated for each amino acid in polypeptide synthesis? Select all that apply. You may select multiple options. Opeptide bond formation O Ribosome scanning for initiation codon AUG O binding of second aminocyl-tRNA Otranslocation
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omissThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
- mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAGIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G