Q: Briefly explain how the color of your pigment relates to its absorbance spectrum
A: The color of a pigment like chlorophyll depends upon its absorption spectrum. In case of…
Q: You would like to create new hybrid strains between various cereal grains of different ploidies.…
A: Sterility usually results from different chromosome numbers in the parents, when the parents are…
Q: how do cocaine and amphetamines differ in their mechanism of action?
A: Many drugs can have side effects or interactions with other medications or substances, which can be…
Q: Which kind of pathway describes glycolysis best? O a) glycolytic and aerobic b) aerobic and…
A: Q.13 Ans:- Explanation:- Glycolysis is a series of events where glucose molecule gets broken down…
Q: Touching each other means what?
A: In human literature, sexual motivation—also known as sexual desire—refers to the likelihood of…
Q: 1. Use the words presented in below to create a concept map illustrating the relationships among…
A: The "Five I's" framework by Cowan and Smith (2018) is a commonly used approach for microbiological…
Q: A facultative aerobe can live only in the absence of oxygen. True False
A: Bacteria is a ubiquitous microscopic prokaryotic organisms which does not have membrane bound…
Q: The function of oxygen in oxidative phosphorylation is to accept electrons during the citric acid…
A: Introduction: The citric acid cycle, also known as the Krebs cycle or TCA (tricarboxylic acid)…
Q: 3. Infer Why do you think more than 54% of U.S. wilderness areas are located in Alaska and only 2.7%…
A: Introduction : The scientific field of demography analyzes population dynamics, changes in size,…
Q: In seeds, the lipoxygenase (LOX) enzyme breaks down larger fatty acids into smaller molecules that…
A: In seeds, the lipoxygenase (LOX) enzyme breaks down more considerable fatty acids into smaller ones,…
Q: How does cystic fibrosis affect facilitated diffusion?
A: Introduction Cystic fibrosis is a genetic disorder that affects the function of the cystic fibrosis…
Q: The Generation of Clonal Diversity Is genetically controlled Causes multiples of the same type of…
A: Introduction Clonal diversity is the process by which the immune system generates a large number of…
Q: explain how fatty acids can participate in the formation of a proton gradient in the intermembrane…
A: Introduction :- Fatty acids are a type of molecule that are an important source of energy for the…
Q: Assume that a gene controls the expression of a trait in which affected children occur only in…
A: Using a Punnett square can help us to understand better the principles of inheritance and how they…
Q: Consideration Number of protons pumped across the ETC when NADH donates 2e-? Number of protons…
A: ETC stands for Electron Transport Chain, which is a series of membrane-bound protein complexes and…
Q: Design, conduct and summarize results of the analyses outlined below using data collected in the…
A: The question is asking you to analyze the Framingham Heart Study data set using FHS-Exam1, which…
Q: 2. If a woman who has no dimples (recessive) and is homozygous free earlobes (dominant) has children…
A: Introduction Homozygous and heterozygous are terms used to describe the genetic makeup of an…
Q: The 500-milligram dose of vitamin C provided by this dietary supplement is 1 less than the RDA for…
A: Introduction Vitamins are very essential for our metabolic activities. Vitamins are classified as…
Q: In the past 500 million years there have been ________ mass extinction events. A. two B.…
A: Introduction Extinction refers to the complete disappearance of a species or group of organisms…
Q: 2. If a woman who has no dimples (recessive) and is homozygous free earlobes (dominant) has children…
A: Given that, having dimples is dominant over no dimples while earlobes is having incomplete…
Q: 4. Purple Flowers In another one of Mendel's experiments, he crossed the offspring. Two pea plants…
A: Introduction A Punnett square is a tool used by geneticists to predict the potential outcomes of a…
Q: What does osmosis including the concept of concentration have to Dow it's lactose
A: A solution is composed of two components which are solute (particles that needed to be dissolved)…
Q: Which of the following electrolytes are absorbed only when needed a. Iron O a O b b. Calcium c.…
A: Introduction - Electrolytes are substances that, when dissolved in water or other solvents, can…
Q: This diagram is of a mitochondrion. Which label shows the site of the citric acid cycle? E Chris a)…
A: Cell is an elemental unit and part of structural organization of body which comprises of various…
Q: James Lind conducted a research study in which he divided 12 sailors into six pairs and gave a…
A: Experimental study consists of an independent variable, dependent variable and control variable.…
Q: 1. What are chromosomes made of? 2. Compare and contrast mitosis and meiosis. 3. How does mitosis…
A: Introduction : The basic biological, structural, and functional components of all living things are…
Q: garden peas tall vine is dominant over short vine and round pea pod is dominant over wrinkled pea…
A: Introduction: The phrases heterozygotes and homozygotes are used to characterise a person's genetic…
Q: For the following problem please refer to the following significance table: Degrees of freedom (n) 1…
A: The dihybrid cross is one in which the two parents differ in two traits. In a dihybrid cross, the F1…
Q: Lactose Energy Source Energy Storage Structural Sucrose Glucose Glycogen Carb Concept Card E Dextran…
A: Carbohydrates are a group of biomolecules that consist of carbon, hydrogen, and oxygen atoms,…
Q: explain precisely and concisely why hibernating animals accumulate large amounts of fat during the…
A: Hibernation is a profound rest that assists them with saving energy and endure the colder time of…
Q: Question 2 Which of the following will not directly influence blood glucose concentration? (A) high…
A: The body automatically and continuously regulates its glucose levels every minute of the day. To…
Q: order to investigate the action of a bacterial membrane protein that is a light-driven proton pump,…
A: Interior of liposomes turns blue means that the pH of liposomes on the interior side becomes high or…
Q: What is the current legal status of abortion? What are the various types of abortion procedures?
A: Introduction :- Abortion is the termination of a pregnancy before the fetus is viable, meaning it is…
Q: Under aerobic conditions when glucose is limiting, with high ratios of NADH/NAD+ and ATP/ADP, as…
A: Introduction : Glycolysis is a metabolic mechanism that occur in both aerobic and anaerobic…
Q: 3. We made 450 mL of 2.5% Luria Broth (LB) for our bacterial cultures. a) What is the final…
A: Every biological cell requires some kind of energy (nutrients) for its growth and development. For…
Q: How does the pathogenic microorganism mycobacterium tuberculosis secretes lipids called mycolic…
A: Introduction Mycobacterium tuberculosis (Mtb) is a pathogenic bacterium that causes tuberculosis…
Q: Make specific reference to the Nernst equation but there is no need to cite or calculate any…
A: This question pertains to the topic of electrolyte balance in the body, specifically potassium (K+)…
Q: what are contributing factors with adolscents in unintentional injuries from vehicular accidents?
A: Introduction: Injuries refer to any physical damage or harm to the body that is caused by external…
Q: In which order do the stages of aerobic cellular respiration occur? O a) glycolysis, citric acid…
A: Glycolysis - The breakdown of glucose into two pyruvate molecules in the cytoplasm of the cell.…
Q: 5 Cleft chin 15 니 19
A: The Hardy-Weinberg Equilibrium formula is used to calculate the frequency of alleles in a population…
Q: Monique is a young child who is enthusiastic about animals. One day, she says, "dogs," "cats,"…
A: Overregularization is described as "the application of a principle of regular change to a word that…
Q: Throughout downstream processing, various analytical methods must be used to evaluate the…
A: In downstream processing, analytical methods are used to separate the desired product from a mixture…
Q: Overall, making healthy lifestyle choices and being proactive about cardiovascular health can lead…
A: The heart is the muscular organ that is crucial to life as it stands beating from early fetal life…
Q: A man suffers from an E. coli (gram negative) infection. After taking antibiotics, blood tests…
A: E. coli (Escherichia coli) is a type of bacteria that is commonly found in the intestines of humans…
Q: D. Sex-linked In humans, hemophilia is a sex-linked trait. Females can be normal, carriers, or have…
A: Haemophilia has an X-linked recessive inheritance pattern. One of the two sex chromosomes, the X…
Q: Dead Zone Volume (10⁹ m³) 7 6 N 1 0 Figure 1: Relationship between nitrogen input and dead zone…
A: The term "Dead Zone Volume" of a lake is used to refer to the amount of dissolved oxygen available…
Q: Anthocyanins are another type of plant pigment that are purple or red. Say you run a chromatography…
A: Chromatography is a method of separation in which the analyte is mixed with a liquid or gaseous…
Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC
A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…
Q: the blood brain barrier is described as a/an O barrier to all druges reaching the brain O selective…
A: Introduction The brain is a complex organ that serves as the control center of the nervous system…
Q: E1 and E2 of the pyruvate dehydrogenase complex is coupled via: (d) Transfer of an acetyl group…
A: Pyruvate Dehydrogenase Complex: The pyruvate dehydrogenase complex (PDC) is a multienzyme complex…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Match the following structures with their descriptions:(1) true vocal cords(2) false vocal cords(3) larynx(4) visceral pleura(5) alveoliA. serous membrane on lungsB. contains the vocal cordsC. vibrate to make soundD. air sacsE. muscular foldsBrett and Aaron are both 21-year old males. Their vocal tracts are both 17 cm, but they have different sized vocal folds. Brett's vocal folds are 21mm long and Aaron's are 23mm long. You are comparing power spectra of them sustaining the /i/ vowel at their speaking fundamental frequency. Which statement below, regarding Aaron's harmonics and formants, is true? Aaron's harmonics are spaced more closely together than Brett's O Aaron's harmonics are spaced further apart than Brett's O Aaron's formants are located at higher frequencies than Brett's O Aaron's formants are located at lower frequencies than Brett'sAccording to the Source Filter Theory of vowel production, during sustained phonation changing the shape of the vocal tract will change the frequencies of the harmonics. True or false
- The true vocal cords attach to the cartilages. arytenoid corniculate cuneiform O epiglottisconsidering the nasal tract, soft palate, hard palate, teeth, your tongue, your lips, epiglottis, vetricular folds, laryngeal ventricle, thyroid cartilage, vocal folds and cricoid cartilage... describe three interesting facts or topics on the human voiceWhat must happen to the vocal folds to produce a higherpitched sound? A lower-pitched sound? What produces a loudersound?
- Why does the Vocal fold have peaks and valleys when vibrating?When altering fundamental frequency why do we change the stiffness and thickness of the vocal folds?You are working with a client who is unable to contract the cricothyroid muscle, which is the muscle that helps the vocal folds stretch and change length. What maximum performance measure do you expect they will experience the most difficulty completing? O Maximum Phonation Frequency Range O Maximum Phonation Time O Dynamic Range O s/z ratio
- When tension in the vocal cords increases, what happens to the pitch of the voice?Describe the action of the vocal cords in speech?Randall sustained phonation and in the middle chanced the configuration of his vocal tract. You measured a decrease in the frequency of formant 1. How did Randall change his vocal tract? O His tongue based moved upward. O His tongue base moved downard. O His tongue blade moved forward. O His tongue blade moved backward.