Which of the following is NOT true for proto-oncogenes? O cause a gain in function O mutations are analogous to putting your foot on the accelerator O are dominant, so one allele causes effect mutations are analogous to taking your foot off the brake
Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…
A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…
Q: All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the…
A: Removal of intron sequences is splicing.
Q: What are the concepts behind osmosis and enzymatic browning in potatoes?
A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…
Q: •What the different columns in a cohort life table represent.
A:
Q: A. Tabulate your data. How commonly related the following species with each other? Monkey Mouse Rat…
A: The molecular sequence are frequently viewed as more dependable than those constructed from…
Q: Identify one Filipino scientist, Research on his contributions in the field of science, make a brief…
A: A biologist is a scientist who does biological study. Whether that's a single cell, a multicellular…
Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…
A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…
Q: Because of oxygen and nutrient requirements, cells in a tissue must reside within 100 μm of a blood…
A: Mammalian cells require nutrients and oxygen to survive, so they are found within 100 to 200 mm of…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Explain about dideoxy chaintermination sequencing ?
A: Dideoxy chain termination method is also called as Sanger sequencing. This method can be designed…
Q: nucleotides - adenine, guanine, cytosine, and thymine?
A: 1. DNA is made up of long chain polymer of polynucleotide. A nucleotide consist of nitrogenous…
Q: What is the final electron acceptor for anaerobic organisms? What does this mean
A:
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: Introduction : 4 alleles control coat colour of guinea pig Black = B Sepia = S Cream = C Albino…
Q: In prokaryotes, the sigma factor recognizes base sequences in the _____ which facilitates RNA…
A: Answer - promoter
Q: According to evolutionists, which is the best test to show the relatedness of two organisms?
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: Using tables 2.1 and 2.2 as references, fill out the following table. The first item is given as an…
A: Geological time scale Geological time scale is a representation of Earth's history.
Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…
A: Inheritance Inheritance is the biological process from which the genetic material is transferred…
Q: Vhich of the following are required to set up a CRISPR-Cas9 experiment to fix a mutation in a gene…
A: CRISPR or Clustered regularly interspaced short palindromic repeats is a gene editing technique in…
Q: All may be RNA polymerase Il promoter constituents EXCEPT: (A a TATA box upstream the transcription…
A: * promoter is sequence of DNA where proteins binds initiate transcription of RNA from DNA downstream…
Q: (b) Describe the role of invariant chain, CLIP, HLA-DM in the antigen presentation process.
A: Invariant chain plays important role in functioning of MHC class II molecules.
Q: Describe ONE likely mechanism of action of a caspase inhibitor. Explain why an inhibitor for…
A: Caspases are expressed inside cells as inactive precursors that must be activated in order to cleave…
Q: The genetic description of an individual is its genotype, whereas the genetic description of a…
A: Introduction Genetics is the study of genes and heredity, or how specific attributes or traits are…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Eukaryotic and prokaryotic RNA…
A: Prokaryotes have only one RNA Polymerase, while eukaryotes have three (RNA Polymerases I, which…
Q: How much larger is the global ecological footprint todaythan it was half a century ago?
A: Ecological footprints in simple ways can be defined as the productivity of area of the land or water…
Q: Describe briefly the generation of the active form of the transcription factor NFAT. Include the…
A: Nuclear factor of activated T cells (NFAT) was first identified as a Ca 2+/calcineurin-regulated…
Q: DNA polymerase delta has Pril subunit that can generate RNA primers True false
A: DNA polymerase alpha is the eukaryotic polymerase associated with primase activity.
Q: The MN blood group is of interest to population geneticists because (a) people with genotype MN…
A: Blood is classified into four types based on the presence or absence of antibodies and antigens on…
Q: Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse…
A: Action potential Is an instantaneous, fast, temporary, and spreading change in the resting membrane…
Q: Describe the various functions of the thyroid gland. Creat a data table comparing and contrasting…
A: The thyroid gland is a butterfly-shaped gland located immediately above the collarbone in the neck.…
Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…
A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…
Q: Discuss the consequences of diabetes - For example cardiac arrest, loss of limp and other health…
A: Diabetes or diabetes mellitus is a condition in which blood glucose levels are abnormally either due…
Q: What types of gene changes are most associated with the evolution of new anatomical features in a…
A: A specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and serves as…
Q: Process: Production of glutamic acid from sugarcane molasses by corynebacterium glutamicum. Please…
A: There are about 22 amino acids. Some of the amino acids can be synthesized in our body, hence known…
Q: Why has the American medical profession risen to itspresent heights?
A: Medical profession is field which provides health care services to patient.like pharmacy, hospital,…
Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…
A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…
Q: Suppose a mammal’s tidal volume is 2 L, its tracheal volumeis 80 mL, its anatomical dead space…
A: In marine mammals, the tidal volume (the amount of air breathed in or out during normal respiration)…
Q: Aromatase inhibitors are a new generation of drugs used to treatwomen who have estrogen-sensitive…
A: In 70% of the cases of breast tumor estrogens fuel the growth of a tumor. It stimulates the growth…
Q: In chapter 8 we read that in tumor cells Rb protein is hyperphosphorylated. In response to that,…
A: p53 suppresses the cell proliferation mediated by the Rb-E2F pathway. Phosphorylation of Rb by…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…
A: Lowest weight = 5 lbHighest weight = 29 lbWeight difference = 24 lb 3/768 = 1/256 Four genes each…
Q: What evidence led Emil von Behring to discover antibodies and the complement system in 1905?
A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…
Q: Question 16 The mechanism of activation of eukaryotic genes involves addition and removal of…
A: Gene is a stretch of RNA that encodes a functional product either in the form of RNA or a protein.…
Q: List and describe three changes in muscles that occur duringendurance training and explain how each…
A: Three changes in muscles that occur during endurance training are: a slower utilization of…
Q: Define microevolution.
A: Introduction:- Evolution is the process of a species' features changing over numerous generations…
Q: Combining your knowledge of rates of diffusion with yourknowledge of muscle physiology, explain why…
A: Slow-twitch (Type I) fibres, which are characterised by muscles with lengthy contraction duration…
Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…
A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…
Q: overlapping one another and amplifying themselves. Where do you expect to see bands of Primer dimer…
A: Primer dimers are commonly caused due to contamination of our DNA sample and can be observed as a…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…
Q: provide an example of a clinical scenario where a Type A patient has wild type A alleles at the ABO…
A: The ABO blood grouping is controlled by an 'i' gene. This gene has two alleles iA and iB. Both these…
Q: Question 17 Match the following Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and…
A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- L A Moving to another question will save this response. Question 5 Select the correct statements 0 An oncogene is a cancer producing gene A proto-oncogene is only found in cancer cells Tumor suppressor genes are genes whose normal products inhibit cell division A proto-oncogene is a normal cellular gene that has the potential to become an oncogene A Moving to another question will save this response.A Moving to another question will save this response. Question 34 Which of the following phenotypes is an example of a temperature-sensitive conditional mutation? O Siamese cats O Tay-Sachs O Phenylketonuria O Achoncoplasia O Porphyria A Moving to another question will save this response. MacBo * F2 20 F4 2$ 2 3 4. R A S 6 L E.I need help answering the following question from the following article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2762880/ Science and Society: In 1966, Stanley Gartler presented his findings at an international conference- 18 of the most commonly used cell lines all contained the same genetic marker, G6PD-A. This gene allele is found almost exclusively in African Americans. This was a problem because a large number of these cell lines, excluding HeLa cells, were established from Caucasian individuals. He suggested that these lines were in fact contaminated with HeLa cells, which proliferate at extreme rates and were used in labs all over the world. What would you expect was the response of those scientists using the “contaminated” cell lines? Do you think this marker is enough to establish this contamination?
- Enhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. Did the modified or the unmodified mice learn the location of the platform faster in the first test?Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 2. Did the modified or the unmodified mice learn the location of the platform faster in the first test?The gene provides instructions for making a protein called polycystin-2 Group of answer choices PKD2 PKDH1 PKD1 All choices are correct
- Moving to another question will save this response. Question 14 Which of the following best describes a DNA molecule? O1.contains ribose O 2. double helix 3. made of amino acids O 4. contains uracil 5. none of these A Moving to another question will save this response. יו1 ה- AR SONYCorrect answers already provided! Please don't just tell me the answers bc I know them already. Help me with my own question. I get everything else in this problem other than the third option: Introduce the mutant human HD allele as a transgene into the mouse genome with transgene integration anywhere in the mouse genome. Why is the first question (left) okay with introducing mutant human HD allele and the second question (right) is not? I heard that introducing allele without using CRISPR-Cas9 is very rare and difficult. If so, how does it work in the first problem (Hungtinton's chorea)?You've discovered a new gene, G8R. Describe two experiments you could do to determine whether it is a proto-oncogene. Explain the experimental set-up as well a how you would interpret the results.
- Question 20 A mutation which causes a promoter to be more like the consensus sequence is likely to be a O a promoter down mutation a promoter up mutation O a promoter neutral mutation O none of the above Moving to another question will save this response. MacBook Pro 000 000 F1 F2 F3 F4 F5 F6 F7A Moving to another question will save this response. Quèstion 19 True or False: G1 phase is the part of interphase when DNA duplication takes place. O True O False A Moving to another question will save this response. MacBook Air 20 esc F1 F2 F3 24 7 @ 2 4 6 Q E R. T Y. S F V # 3Fill up the blank __________s are blood diseases caused by mutationsthat eliminate or reduce the production of globinpolypeptides from one of the clusters but not the other.These mutations can include deletions of specific genesor the LCR in either cluster.