Which of the following molecules is a nitrogen base that would be found in 1 po DNA? (check all that apply) * Adenine Guanine Uracil Baycil Thymine Qualine Cytosine
Q: saq A certain DNA sample is found to have a makeup consisting of 29% cytosine. Use Chargaff’s rules…
A: Chargaff's rule is a consequence of base pairing. The rule was published in 1950 by the…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for , cytosine, guanine,…
A: The sequence of DNA defines the order of the four chemical building blocks called bases that make up…
Q: If amounts of bases in a DNA molecule are measured, we find OT = A and C = G. OA = C and G = T. %3D…
A: DNA (Deoxyribonucleic acid) is a genetic material present in the nucleus of eukaryotic cell.
Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…
A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…
Q: Suppose there are three tubes containing following samples in the laboratory. The three tubes are…
A: DNA(deoxyribonucleic acid) is defined as the building block of life because it carries all the…
Q: Which of the following is a difference between DNA and RNA? * O DNA is a single strand, but RNA is a…
A: Gene is known as the unit of heredity, which is transferred from one generation to the next. In most…
Q: A sample of DNA contains 40% adenine-thymine base pairs altogether. What percentage of the DNA will…
A: Q. A sample of DNA contains 40% adenine-thymine base pairs altogether. What percentage of the DNA…
Q: Which of the following is considered a "palindrome" in DNA? O GGATCC O AATTAA O CGATAGC
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A double stranded DNA fragment contains 12% adenine residues. What is the percentage of cytosine…
A: According to Chargraff's law, the number of purines equals the number of pyrimidines. Purines are…
Q: Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity…
A: A.The statement: A DNA strand has a polarity because its two ends contain different bases is false…
Q: If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the…
A: Answer- Whenever we isolate double stranded DNA and check their nitrogenous base composition and…
Q: A sample of double-stranded DNA contains 20% adenine. Approximately what percent of the nucleotides…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: DNA nucleotide base pairings: Thymine pairs with ___________________________, Cytosine pairs…
A: DNA is a nucleic acid made up of several units of nucleotides joined end to end. A nucleotide is…
Q: What type of bonds does DNA ligase create between adjacent nucleotides? O a peptide O…
A: DNA replication refers to the sunthesis of DNA from the parental DNA. It takes place in the nucleus.…
Q: As part of their normal function, many proteins bind to DNA briefly and then release it again. Which…
A: DNA and the proteins can interact with each other during the processes of central dogma. Often the…
Q: . Other polar molecules include nucleic acids and some proteins. Look at the DNA sketch provided and…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…
A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…
Q: The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A)…
A: DNA nucleotides are adenine (A), thymine (T), guanine (G) and cytosine (C). These nucleotides come…
Q: Two nucleotides are linked together in a sequence of DNA via a phosphoanhydride linkage. True Or…
A: Nucleotides are primarily responsible for the formation of polynucleotides (nucleic acids) of the…
Q: 1. Guanine always pairs with. 2. Thymine always pairs with 3. Fill in the complementary nucleotides…
A:
Q: Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A+G=C+T…
A: DNA is a double stranded molecule with complementary base pairing. Complementary base pairing occurs…
Q: . You have a sample of DNA, and you measure the amount of adenine present at 21%. Based on this, the…
A: DNA stands for De-oxy ribonucleic acid and it contains four nitrogenous bases along with the sugar…
Q: The two strands in a molecule of DNA are held together by peptide bonds covalent bonds hydrogen…
A: The DNA double helix is held together by two types of bonds, covalent and hydrogen. Covalent bonds…
Q: Which of the following statements is true of double stranded DNA? The double stranded structure is…
A: DNA is stabilised by hydrogen bonds, base stacking interaction, hydrophobic force, ionic…
Q: A nucleoside consists of (A) Nitrogenous base (B) Purine or pyrimidine base + sugar (C) Purine or…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A double-stranded molecule of DNA has 80 T nucleotides and 110 G nucleotides. What is the TOTAL…
A: DNA and RNA make up the majority of genetic material. DNA is the genetic material that controls the…
Q: If a DNA molecule is 22% adenine in any organism, which percentage of thymine will that DNA molecule…
A: Ist question's solution : In dna, adenine base pairs with thymine and guanine base pairs with…
Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…
A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine. Hence, option (c) is…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: Which of the following statements is false? O Both DNA and RNA have negative charge O RNA contains…
A: DNA and RNA are the nucleic acids where DNA is double stranded and can replicates on it's own. On…
Q: complementary DNA sequence
A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…
Q: If DNA sequence is CCGACG what would be the amino acid sequence ( read from left to rig TRNA…
A: The process of decoding the genetic code contained within a messenger RNA (mRNA) molecule to produce…
Q: Which of the following is found in a molecule of DNA? ribose phosphate groups deoxyribose…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: w many hydrogen bonds can be formed between Guanine and its normal ring partner in double-stranded…
A: Ans- 3 hydrogen bonds
Q: Which of the following correctly shows complementary base pairs in DNA and RNA? a.DNA= A:T & G:C b.…
A: Both ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are composed of nucleotides. And a…
Q: In a single strand of DNA, the individual nucleotides are covalently linked together by bonds,…
A: The DNA or deoxyribonucleic acid is a nucleic acid and it is made up of two strands. In the DNA the…
Q: Which row shows the percentage base composition of the template strand of the original DNA molecule?…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A:
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: Which of the following make up a nucleotide A phosphate + sugar B base + sugar + phosphate base +…
A: The correct option is B) base+sugar+phosphate=nucleotide
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Introduction : The DNA molecule which is the genetic material found in all living organisms, is made…
Q: DNA molecules are made of small units called nucleotide. Which of the following is not part of a…
A: A nucleotide is a type of organic molecule that makes up DNA and RNA. They play a role in cell…
Q: Which of the following does not code for an enzyme having both helicase and nuclease activity?a)…
A: Genetic recombination is the exchange of genetic material between different organisms which leads to…
Q: What is a DNA nucleotide? A chain of DNA subunits The building block, or basic unit, of DNA A…
A: DNA is a double helical molecule. It is found in the nucleus of the cell in the chromosome. It acts…
Q: Cytosine 1. Cytosine found in DNA pairs with: Uracil 2. Guanine found in RNA pairs with: Guanine 3.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of the following is NOT either stated or predicted by Chargaff's rule? O #G's = #A's in DNA. O…
A: Chargaff's rule states that the stoichiometric ratio of purine and pyrimidine ratio of DNA is 1:1.
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…
Q: Cytosine (C) makes up 30% of the nucleotides in a sample of DNA. What percentage of the sample is…
A: DNA has 4 nitrogenous bases which hold DNA strands together by hydrogen bonds. Adenine, Guanine,…
Q: Nucleosides differ from nucleotides by: The loss of the 2'-OH group ○ The addition of a 3'-OH group…
A: Nucleotides are the building blocks of nucleic acids. Nucleotides consist of sugar, base and…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11 12 13 NH2- G C G N V T H N Q C V L S -COOH If expressed in a eukaryotic cell (please mark your answer in the blank space): Position(s) ___ could be N-glycosylated Position(s) ___ could be modified with myristic acid and the bond formed would be a ______________ Position(s) ______and _____ could be modified with palmiti c acid and the bond formed would be a ______________ Positio n(s) ________ could be a segment of a lipid-linked protein with a farnesyl anchor and the bond formed would be a ______________ Position(s) ________ could be a segment of an O-glycosylated protein Position(s) ________ could be modified with a glycosylphosphatidylinositol (GPI) anchor Position(s) ________ could be phosphorylatedThere is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letter
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.Draw a peptide for cys-asn- pro-gly (Using the same format in picture)First letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG А