Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the of the root hair Adding de-salinated water to the soil • Increasing concentrations of solutes in the root hair None of these would decrease uptake of water by a plant root hair

Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the of the root hair Adding de-salinated water to the soil • Increasing concentrations of solutes in the root hair None of these would decrease uptake of water by a plant root hair

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter30: Plant Form And Physiology

Section: Chapter Questions

Problem 3VCQ: Figure 30.34 Which of the following statements is false? Negative water potential draws water into...

See similar textbooks

Related questions

Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…

A: The objective of the question is to determine the sensitivity and specificity of a urine test for…

Q: Draw a labelled diagram depicting eukaryotic protein-coding gene containing three exons. Indicate…

A: Approach to solving the question: Diagrammatic approach Detailed explanation: Examples: Key…

Q: Which Roman Catholic Order is correctly matched with its favored metaphysical doctrine? the…

A: The question is asking us to identify which Roman Catholic Order is correctly associated with its…

Q: According to Jean Buridan’s equation, the momentum or “impetus” of an 88 kilogram mass moving at 5…

A: The objective of this question is to calculate the momentum or 'impetus' of an object with a given…

Q: Do the different species of bacteria appear the same or different from each other when grown in…

A: Do the different species of bacteria appear the same or different from each other when grown in…

Q: If someone was planning to have children should they and their partner get tested for a recessive…

A: The question is asking whether prospective parents should get tested for recessive genetic…

Q: Which of Aristotle’s four causes is a definition of the substance of which something is composed?…

A: The objective of the question is to identify which of Aristotle's four causes refers to the…

Q: On a cool day, a crab (a poikilothermic animal) is sleeping on a rock and not consuming any food.…

A: The objective of the question is to understand the effect of temperature on the mass of a…

Q: How does UV treatment act against microorganisms? Why are some microorganisms or cell types more…

A: How does UV treatment act against microorganisms? UV treatment is an effective method for…

Q: Part 1. Stratigraphic Dating: A Café Scene Relative dating methods establish the date of something…

A: Let's delve deeper into the scenario using the Law of Superposition to determine the relative age of…

Q: Which of the following is a reason for the decrease in height with age advancement? Select one: a.…

A: The objective of the question is to identify the primary reason for the decrease in height as a…

Q: 18

A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…

Q: Explain the difference between unidirectional airflow in birds vs bidirectional airflow in mammals.…

A: The objective of this question is to understand the difference between unidirectional airflow in…

Q: Welcome Biological Anthropology LabMore specifically, tell us which topic you are the most excited…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…

A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…

Q: The diagnostic cell in Hodgkin's disease is the: Question 5 options: A)…

A: The objective of the question is to identify the specific cell type that is characteristic of…

Q: 29) The doubling time in the bacterial growth cycle is measured during: a) Prodromal period b) Log…

A: 29 Measuring doubling time during the log phase of bacterial growth:The doubling time of bacteria is…

Q: Activity 8: Bone Conduction In the bone conduction activity, was the sound louder on the side of…

A: The objective of this question is to understand the concept of bone conduction and how it affects…

Q: You are studying a gene that makes a protein product that is important to vision. In which cell…

A: Bone marrow cells of an adult: These cells are primarily involved in hematopoiesis, which is…

Q: Question 23 2 pts In your own words, please explain how the process of meiosis leads to siblings…

A: Meiosis is a cellular process that leads to the formation of gametes with half the number of…

Q: Calculate the number of bacteria (CFU/ml) in each serum and saline sample. What was the purpose of…

A: Calculating CFU/ml in Serum and Saline SamplesTo calculate the number of colony-forming units per…

Q: Explain why pyrimidine is less basic than pyridine

A: The objective of the question is to understand why pyrimidine is less basic than pyridine. This can…

Q: Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).

A: These nucleotides are connected by phosphodiester bonds between the 3' carbon of one sugar molecule…

Q: Warm autoimmune hemolytic anemia, WAIHA, frequently have antibody specificity of: Question 6…

A: In warm autoimmune hemolytic anemia (WAIHA), the autoantibodies produced by the patient's immune…

Q: Which of the Pedigree diagrams below is most likely to show a family with Gaucher Disease?

A: Certainly! Let's dive deeper into the characteristics of a pedigree diagram showing a family with…

Q: You design the following primer: AGCTGG type your answ What is its Tm? °C What annealing temperature…

A: To determine the melting temperature (Tm) of a primer, we utilize the nearest neighbor method, a…

Q: GQ16

A: Refer to the solution

Q: Leghemoglobin is a globin protein found in the roots of Legume plants inoculated with Nitrogen…

A: Legemoglobin is an oxygen carrier which is found in leguminous plants. This has structural and…

Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…

A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…

Q: Genetics Question

A: The objective of this question is to understand the purpose and applications of three key tools in…

Q: * pilot Spring 2024 Introduction to Cell Biolog... Home Content Communication Dropbox Section 7…

A: Approach to solving the question:1. Identify the mechanism of action of tricyclic antidepressants…

Q: 21

A: The question is asking us to determine the percentage of Thymine (T) in the DNA of an organism,…

Q: What group of tests can be done to diagnose chronic myelocytic leukemia? Question 6 options:…

A: The objective of the question is to identify the correct group of tests that can be used to diagnose…

Q: what are the parental genotypes of the orange male and the tortoiseshell female cat

A: In cats, coat color is a genetically complex trait that is determined by multiple genes, including…

Q: You were tasked to conduct a population genetic survey of a diploid insect population. You obtained…

A: When conducting a population genetic survey, such as the one described involving a diploid insect…

Q: Zollinger-Ellison syndrome is a peptic ulcer disease characterized by overproduction of gastric…

A: Approach to solving the Question(s):To answer the question about the two types of stomach cells…

Q: Abraham, traditional founder of the nation of Israel, worshipped a single supreme supernatural…

A: The question is asking us to identify the religious doctrine that Abraham, the traditional founder…

Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 120…

A: The objective of the question is to understand the impact of increasing the time allowed for a…

Q: N 3 13 Which of the following lipid is likely to function as membrane lipid in mammals. O…

A: The objective of the question is to identify the lipid that is likely to function as a membrane…

Q: How is transcription different in eukaryotes compared to prokaryotes? Choose one: • Transcription…

A: The objective of the question is to identify the correct statement that differentiates the process…

Q: Question 1 0.5 pts Which of the following is not one of the 4 main fields of Anthropology? Cultural…

A: 1. Answer:- Modern AnthropologyExplanation:Anthropology is broadly divided into four main…

Q: These types of proteins are responsible for all the following events during cell division: movement…

A: Approach to finding a solution to the problem:1. Determine the most important activities that take…

Q: A buffer solution contains 0.391 M ammonium chloride and 0.239 M ammonia. If 0.0345 moles of sodium…

A: Buffer solutions play a crucial role in chemistry and biology, maintaining a stable pH even when an…

Q: What are the similarities and differences in each part of the forelimb of a moth, Pteradactyl, bird…

A: The objective of this question is to compare and contrast the forelimbs of a moth, Pteradactyl,…

Q: Aristotle’s geocentric model of the solar system, despite its erroneous premise, would remain the…

A: The geocentric model, which posited that the Earth was at the center of the universe with the…

Q: FREQUENCY 60 40 20 0 88842 140 120 100 80 1 3 5 7 9 11 LITTER SIZE 13 15 Which of the following best…

A: Both k and r are strategies for survival. In k selected small number of offspring is produced with…

Q: Huntington’s Disease is a dominant lethal disease that manifests later in life after many people…

A: When individuals are able to gain an understanding of their genetic status, they are able to utilize…

Q: Match the following solutions to examples that address problems for biodiversity.…

A: Haida Gwaii Watchmen - listen to local people's perspectives.The Haida Gwaii Watchmen program is an…

Q: Why is the control of gene expression important for cells? Choose one: It ensures the accurate…

A: The question is asking us to identify the primary reason why the control of gene expression is…

Q: The Shannon Index, H', for community #1 is 1.7; for community #2 it is 1.5. We can conclude that…

A: The Shannon Index, represented as \(H'\), is a measure used in ecology to quantify the diversity of…

Concept explainers

Plant sensory system

The plant sensory system is a sophisticated system that responds to environmental stimuli such as light,temperature, gravity, and touch. Research predicts that plant hormones and signaling mechanisms areresponsible for this regulation system in plants.

Question

Which of the following would tend to DECREASE uptake of water by a plant root hair?

Increasing the of the root hair

Adding de-salinated water to the soil

• Increasing concentrations of solutes in the root hair

None of these would decrease uptake of water by a plant root hair

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following describes what happens in the ROOT HAIR cells? Mineral lons Water pass into the passes into Plant loses plant the plant water by through through transpiration active osmosis transport A Yes Yes No В Yes Yes Yes C Yes No Yes D No Yes Yes
Which of the following processes enables a plant to extract nutrients from the soil? O Nutrient anions (sulfate, phosphate, nitrate, etc) are replaced by Cl on soil particles. Released nutrients become available in the soil water. Anions exchange places with cations during anion exchange, which confuses roots and turns HATS into LATS, after which the endodermis synthesizes a caspian endothelium O Cation exchange facilitates the breaking of covalent bonds between nutrients and soil particles O Protons replace nutrient cations on soil particles
Which the following statement is FALSE:?a. Relative water content is not a very sensitive index because leaves can show strong responses to <2% change in RWCb. Relative water content is not a very sensitive index because it gives no information about the forces for water movementc. Relative water content is equal the ratio of the mass of water in a given leaf over the mass of water when that leaf was fully saturatedd. Relative water content is equal the ratio of the mass of water in a dry leaf over the mass of water when that leaf was fully saturated
For water transport to proceed, the water potential of the leaves must be lower than the water potential of the roots. True False
Plants can transport water from their roots to their canopy regardless of their height. What properties of water make this long distance transport possible? Plants can transport water from their roots to their canopy regardless of their height. What properties of water make this long distance transport possible? Water can dissolve many substances Water has a high specific heat Cohesiveness of water Adhesiveness of water Choices A and B Choices A and C
Which plant water movement process is dependent on transpiration? root pressure capillary action cohesion-tension all of the above
Describe how the water potential of a leaf changes throughout the course of a 24-hour period. What is driving this change? How does the water potential of this leaf compare to the water potential of a root in the same plant during the same period? How does it compare to the soil underneath the plant? Please fast and properly explain.
Root hairs increase the surface area of the root increase water absorption O increase nutrient absorption all of the above none of the above
Choose the statements that apply to transpiration in the cohesion-tension theory. (Check all that apply) Check All That Apply The H-bonds in water allow for cohesion. Water pressure builds in roots to drive water up the plant. Exposed water in leaves evaporates into drier air. Water forms a continuous stream from leaf into the root. In addition to water, heat is lost cooling the plant during transpiration.
Figure 30.34 Which of the following statements is false? Negative water potential draws water into the root hairs. Cohesion and adhesion draw water up the xylem. Transpiration draws water from the leaf. Negative water potential draws water into the root hairs. Cohesion and adhesion draw water up the phloem. Transpiration draws water from the leaf. Water potential decreases from the roots to the top of the plant. Water enters the plants through root hairs and exits through stoma.
e) Complete the table below: Transport method for water Transport method for (passive/ active?) Root Tissue minerals (passive/active?) Epidermis: Cortex: Endodermis: Xylem: 250 Pages 26.7 x 20.3 Ruled Paper • Papier ligné
Water moves up the xylem as a result of: Surface Tension O Gravity O Water Polarity Both surface tension and water polarity. Both surface tension and gravity. O Both water polarity and gravity.