7L.6.2 Part B - Point mutationsThe instructions for assembling polypeptides are contained in DNA. Consequently, mutations in DNA sometimes affect protein structure. A mutation will initially affect a protein's primary structure, but changesat higher levels of structure may follow.Point mutations are mutations that affect a single nucleotide pair in DNA. The figure below shows different types of point mutations and the effects they have on protein primary structure.(a) Nucleotide-pair substitutionWild typeDNA template strand 3' TA C TT CA A A C CGATT5'5' ATGAAGTTTG GCTA A 3'mRNA 5' A U G AAGU U UGG CUA A 3'protein Met Lys Phe - Gly Stopamino end-carboxyl endMissense3'T ACTT CA5'5'AT GAAGTTTGGTTAA 3'U instead of C5'AUGA AGUUUGGUUA A 3'Met Lys Phe Gly StopSilent (no effect on amino acid sequence)T instead of C3'TACTT CA A ATC GAT T5'5'ATGAAGTTTA GCTA A 3'A instead of G5'AUGA AGUUU AGCU A A 3'Met Lys Phe Ser StopA instead of GCAAA instead of T3'TA CAT CA A A C C G ATT5'5'ATGTAG TTT G G C TA A 3'NonsenseU instead of A5'AU GUAGU U UGGU U A A 3¹Met Stop(b) Nucleotide-pair insertion or deletionExtra A3'T A CATT CA A A C C GATT5'5A T G T A A GIII G G CT A A 3Extra U5 AUGUAAG U U UGG CU A A 3¹Met StopFrameshift causing immediate nonsense (1 nucleotide-pair insertion)A missing3'T ACTT CA AC C G ATT 5'5'ATGAAGTT G G C T AA 3′Umissing5'AUGAAGU UGG CUA A...3′Met Lys Leu Ala...Frameshift causing extensive missense (1 nucleotide-pair deletion)TTC missing3' TA CAAACC GATT5'5 ATGTTTG GCTA A 3'AA G missing5'AUGUUUGG CUA A 3'Met Phe Gly StopNo frameshift, but one amino acid missing (3 nucleotide-pair deletion). A 3 nucleotide-pair insertion (not shown)would lead to an extra amino acid. In this activity, you will examine three different mutations.• Drag the white and purple labels to the white targets to indicate what each mutant mRNA codon codes for. (You will probably need to consult the codon table for mRNA .)Drag the pink labels to the pink targets to indicate the type of mutation.Drag the blue labels to the blue targets to indicate the effect on the polypeptide's primary structure.Labels may be used once, more than once, or not at all.Wild-typeMutant 1Mutant 2Mutant 3StopsilentminDNA3′ CTT 5'Val3' CAT 5'5'missensemRNA5' GAA 3 5' GAA 3'GTA 3' 5' GUA 3'3'CTC 5'5 GAG 3' 5' GAG3'3'ATT 5'5' ΤΑΑ 3′ 5 UAA 3'Gluframeshift--extensivemissensegAmino acidGlusubstitutionnonsenseType ofmutationN/Ainsertion ordeletionframeshift--immediatenonsenseEffect onpolypeptidenormal1IIIResetHelp

The genetic code is the set of rules used by living cells to translate information encoded within…

Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA GAA 3 5 GAA 3' CAT5 GTA 3 5 GUA 3 5 GAG 3 3 ATT 5 5 TAA 3 5' UAA 3¹ frameshift--extensive missense Amino acid a Glu d 9 Glu substitution nonsense b h Type of mutation N/A insertion or deletion frameshift--immediate nonsense C Effect on polypeptide normal

Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA GAA 3 5 GAA 3' CAT5 GTA 3 5 GUA 3 5 GAG 3 3 ATT 5 5 TAA 3 5' UAA 3¹ frameshift--extensive missense Amino acid a Glu d 9 Glu substitution nonsense b h Type of mutation N/A insertion or deletion frameshift--immediate nonsense C Effect on polypeptide normal

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 4P: Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair...

See similar textbooks

Similar questions

Which amino acid sequence will form part of which protein structure, and why? Sequence 1: Ser-Phe-Gln-Val-Lys-Leu-His-Tyr-Asp-Val Sequence 2: Glu-Tyr-Leu-Asn-Phe-Ala-Gln-Val-Leu-Arg __Amphipathic beta strand __ Amphipathic alpha helix
Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?
a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four different bases. How many possible unique codons are there?b. If DNA had only two types of bases instead offour, how long would codons need to be to specify all20 amino acids?
Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description (1 paragraph pls): -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation
-100 100 8. This is a helical wheel projection. The following amino acids of your protein were predicted to participate in an alpha helix: DRMVEHACKSI. a. Plot these amino acids in the helical wheel projection below. b. Is the alpha helix in your protein hydrophobic, amphipathic or hydrophobic? c. Would you expect this helix to be on the interior of the protein, exposed, or partially exposed?
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hp
The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between eukaryotic cells. O Salt bridges form between oppositely charged histones and DNA in an aqueous environment. Nitrogenous bases are in the interior of the helix, when DNA is in an aqueous environment. Oil forms a homogenous mixture with polar solvents, like acetone.
STRUCTURE OF DNA Ueing the complementary base pairing rules in DNA, complete the following base pairs: Adenine - Cytosine -i Guanine -i Thymine - : Adenine : Cytosine :: Guanine :: Thymine 1
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
a) Canonical forces in protein folding. Describe how these forces come into play when a protein folds. Why do are other intermolecular interactions important to fully understand folding processes?
Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?