Write a program that reads a file containing two columns of floating-point numbers Prompt the user of the file name.Print the average of each column. java
Q: Write a Java program that allows the user to specify a file name on the command line and prints the…
A: The program for the above problem is given below:
Q: 1. Write a java program that will add all the "Composite Numbers" found in a "Comma Separated" file.…
A: ALGORITHM:- 1. Create the file and insert data in it. 2. Read the file and calculate the sum of…
Q: Suppose that you are implementing a program to write a string “CSE 110” in a binary file. Java…
A: For the given functions, we need to find the number of bytes that will be written by each of these…
Q: Write a program that prompts the user for a file name, then reads that file (assuming that its…
A: Hello Student, hope you are doing well, I will be trying my best to explain and fulfill your query.…
Q: Write a program which reads from a file all digits and prints the largest number which is a multiple…
A: C++ program: #include<iostream>#include<fstream> using namespace std; int main() {…
Q: Write a program that reads a file one character at a time and prints out how many times each of the…
A: File name: “Vowels.java” import java.io.FileInputStream; import java.io.FileNotFoundException;…
Q: Write a Python program to count the number of lines in a text file. Then, finally print the total…
A: len is used to find the length of iterable readlines() method will return us the contents in file as…
Q: NEED HELP PLEASE! Write a Java program to read a text file (command line input for file name),…
A: import java.io.*; public class Test{ public static void main(String[] args) throws IOException {…
Q: Write a java program to read from the Keyboard name of the item and its price until the user Enter…
A: Step 1 : Start Step 2 : In the main method , declare the array of strings to store the item names…
Q: Please write a Java program that will read in 5 strings stored in a text file called: dataln.txt.…
A: 1. Create class readwrite a. Create method read data i. open file using…
Q: Write a program that will read the file text.txt which is provided and the encrypted message in…
A: Program code: //import the required packages import java.util.*; import java.io.*; //define a…
Q: 1. Write a Java Program to Reverse the Contents of a File and Print it (Use EilelnputStream and…
A: For this program, the following steps need to be taken: Reading file using FileInputStream and…
Q: A scanner in the department stores reads in the following string (simulate with file input)…
A: Actually, the code has given below:
Q: Write a program that removes all the occurrences of a specified string from a text file. For…
A: This program is done with java file operations. So initially reading the file arguments from the…
Q: Write a Java program to create a file in the same directory on which the program is running. Take…
A: Algorithm: Start Read file name Create a new File object 'f' by passing file name Using…
Q: Write a Python program that asks the user to input a number (n) and a name then the program will…
A: In this question, we are going to write a python program that gets the input from the user and…
Q: Write a python program that reads from a text file whose name is provided by the user (see a sample…
A: Program code: #input of filenamefilename = input("Enter input filename: ") try: # open the file in…
Q: Write a Java code that reads an input file and display the sum and the average. (submit the code and…
A: Here I have used the Scanner class object to read the file having data. Next, I have used a while…
Q: Write a program in java to read from an input file containing text data and then write the text in…
A: We need to read the source file and destination file,then we need to copy the content line by line…
Q: write a Java program to find the longest word in a text file then display that word and write it to…
A: Algorithm: Start READ fileName Open fileName in reading mode Scan the file and find the longest…
Q: this file is named HW3.Java can someone run it through a GNU compiler and please show me the outputs…
A: The output is shown below.
Q: Given the binary file "PHYS101.dat" that has the Ids of students who are taking the course PHYS101…
A: Here I have read the content from both the files and then added the student id to 2 different lists.…
Q: Write a program that use the existing file, read the integers and display them in reverse order…
A: import java.util.*; class main { // Recursive function to print from N to 1static void…
Q: Write a program that reads a student's name followed by five test scores. The program should output…
A: The coding implementation is implemented in C++ language:
Q: Write a C++ program that reads data from a file containing integers that ends with -999 and Output…
A: The program is written in C++ #include<iostream> #include<stdlib.h>…
Q: Write a Java program that asks a user to input a text file name which contains no punctuations reads…
A:
Q: • Read a file containing text and delete the Turkish characters in the file. • A single Turkish…
A: The code of the following is given below.
Q: Write a C++ program that reads a file named words.txt and counts and prints the total number of…
A: In step 2, you will the C++ code. In step 3, you will get the screenshot of the code.
Q: Write a PHP program to count the number of characters words or paragraphs in a file
A: Lets see the solution.
Q: write a program with python that asks the user to enter two filenames. One file contains a list of…
A: Note: Follow proper indentation as specified in the code snapshot while implementing code. Random…
Q: Write a Java program that does the following: 1. Read 10 integer values from a text file. a. The…
A: Answer:
Q: Write a Java Program to perform the following operations using FileOutputStream and FileInputStream…
A: Note: This code should be rewritten instead of copying to the compiler otherwise it will throw a…
Q: Write a program in python language using basics that takes multiple student marks as input. If a…
A: Use an infinite loop to accept input from user and exit from loop if the user input marks is…
Q: Write a Java program to print a version of the user entered string, where for every star (*) in the…
A: Required: Write a Java program to print a version of the user entered string, where for every star…
Q: write a Java program , to write data into a file ( output.txt ). The output.txt file is below.…
A: Java program to write the data into the file named output.txt The given output is 1 22 333 4444…
Q: Write a Python program that reads each line of an input file temperatures.txt that consists of a…
A: inputfile=open('temperatures.txt','r') #Opening the temperatures.txt…
Q: Write a program to read and store four student’s name and their Salaries, sort them into an order…
A: Write a program to read and store four student’s name and their Salaries, sort them into an order…
Q: Write a program to read and store four student's car number and their distances, sort them into an…
A: For this problem, a class Student with instance variables id, car number and distance is created.…
Q: : Write a program that reads a file containing exactly 10 lines, each line contains exactly 10…
A: For the given question i have given python code with proper output below hope it will help you.
Q: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and then…
A: Task: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and…
Q: program that reads 5 integer numbers from a file"integer.txt",and store sum and average in…
A: Program: # python version 3import sysdef main(): # open the file read_file =…
Q: Write a python program that reads from a text file whose name is provided by the user and including…
A: Explanation:
Q: Please write a Java program , to write data into a file (output.txt). The output.txt file is below.…
A: Introduction Please write a Java program, to write the data into the file (output.txt). The…
Write a program that reads a file containing two columns of floating-point numbers Prompt the user of the file name.Print the average of each column. java
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Program in JAVA using While Loop Write a program that takes a positive integer input and prints the numbers starting from input until 0 in one line where each numbers are separated by a space. Note: There's an initial code prepared for you. Go directly to the code editor file and complete the solution. Input 1. A positive integer input Output Enter a number: 5 5 4 3 2 1 0Using Java PrintWriter, write a program that prompts the user for information and saves it to a text file File name is musicians.txt Use this information below: George,Thoroughgood,54321 Ludwig,Van Beethoven,90111 Edward,Van Halen,12345Hi, i need help with this program using Java. Write a program that reads the file AdventuresInWonderland.txt one line at a time and prints the count of each of the five vowels followed by a count of the consonants in the file. Coding requirements: Read the text from the file AdventuresInWonderland.txt. Use a single while loop to read the lines of the file. Use a single for loop to iterate over the characters in each line. Use a single switch statement to determine which counter to increment. Notes: The input may contain punctuation and digits as well as letters. Account for both uppercase and lowercase letters. Character.toLowerCase(ch) returns the lowercase character corresponding to ch(char ch). Character.toUpperCase(ch) returns the uppercase character corresponding to ch(char ch). Character.isLetter(ch) returns true when ch is an alphabetic letter Expected output: Vowels found: a: 324 e: 455 i: 251 o: 300 u: 109 Consonants: 2384 Example: If one creates a Scanner as…
- Need help writing this java code, it has three objectives: to process strings to compare, search, sort, and verify location of specific pattern to output result via interface Description Write a Java program to read a text file (command line input for file name), process the text file and perform the following. Print the total number of words in the file. (When using java_test.txt, I calculate the number of words, including number, as 254.) Print the total number of different words (case sensitive, meaning “We” and “we” are two different words) in the file. (When using java_test.txt, I calculate the number of different words, including number, as 168.) Print all words in ascending order (based on the ASCII code) without duplication. Write a pattern match method to find the location(s) of a specific word. This method should return all line number(s) and location(s) of the word(s) found in the file. Print all line(s) with line number(s) where the word is found by invoking the method…Computer Science C++ Create a text file "input.txt" with a certain amount of integers (you decide how many). Write a program that reads these numbers from the file, adds them, and when you have reached the end of the file, calculates the average of these numbers. Print a message and the average to the console. Code this program twice, demonstrating the two methods to detect the end of the file, part A: reading a value from Instream and storing it (boolean expression) in the while loop part B: using the eof() member functionThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
- The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAJava: Write a program to read first 50 characters from a file named “input.txt". Write those 50 characters into another file named "output.txt". If the first file does not contain 50 characters, write "Not enough characters" in console output.The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
- Using Java: A hotel salesperson enters sales in a text file. Each line contains the following, separated by semicolons: the name of the client the service sold ( Dinner, Conference, Lodging) the amount of the sale the date of the event. Write a program that reads such a file and displays the total amount of each service category. Display an error if the file does not exist or the format is incorrect.Write a program to calculate students’ average test scores and their grades.You may assume the following input data is read from a text file.Johnson 85 83 77 91 76Aniston 80 90 95 93 48Cooper 78 81 11 90 73Gupta 92 83 30 69 87Blair 23 45 96 38 59Clark 60 85 45 39 67Kennedy 77 31 52 74 83Bronson 93 94 89 77 97Sunny 79 85 28 93 82Smith 85 72 49 75 63Use three arrays: a one-dimensional array to store the students’ names, a (parallel) two-dimensional array to store the test scores, and a parallel one-dimensional array to store grades. Your program must contain at least the following functions: a function called GetData to read and store data into two arrays, a function called Average that is used to calculate the average test score and grade, and a function called PrintResults to output the results. The student names should be to the left with a width of 10 columns. The test scores should be to the right with a width of 8 columns. Have your program also output the class average on a line…Implement the following programs in cpp code; Write a program to convert all the characters in uppercase in a file txt. Write a program to find a string “is” from a file txt. Write a program that takes input in 100 students(id, name, age, gender) and write their data in file student.txt and find from file how many students are of age 18. Write a program that takes input in 50 employees(id, name, salary, age) and write their data in file employee.txt and find from file salary of an employee with id 13.