Q: What is the importance of Carbonate/Bicarbonate buffer system for the oceans. What would happen if…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: .) Kerry's folate intake was low at 59% of the DRI. Why is this a concern? A.) she is a…
A: Answer : a) She is child bearing age female Reason : The risk of neural tube abnormalities in your…
Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…
A: A technique called molecular docking examines how molecules are oriented and conformed within a…
Q: When a cell uses fats for aerobic cellular respiration, it first hydrolyzes (breaks down) fats to…
A: Introduction :- The process of cellular respiration that occurs in the presence of oxygen gas in…
Q: Overview of Cell Signaling Pathways Q7.2: A first messenger molecule activates a receptor that…
A: Cells receive and respond to signals from their surroundings. This is accomplished by a variety of…
Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…
A: Introduction Gene expression is the process through which a gene's information is used to create a…
Q: Plz answer this all questions What muscle in the shark is homologous with the geniohyoideus in…
A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…
Q: Factions in our cells happen in a perfect way , therefore DNA replication is error free
A: Ans: DNA replication is defined as the process in which a double stranded DNA molecule is duplicated…
Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…
A:
Q: Consider the figure attached, showing seven people studied between point A and B, and where the…
A: Prevalence of an illness = Number of people in the sample with illness/Total number of people in the…
Q: WHO is Henry Lowe ? what what did he created?
A: Dr Henry Lowe was born on April 9, 1939. He is a scientist and businessman in the health industry.…
Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…
A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…
Q: Draw and label a 2n=4 cell going through anaphase II of meiosis.
A: Eukaryotic cells in advanced multicellular organisms undergo two types of cell divisions - mitosis…
Q: On October 29, the North Carolina Division of Public Health (NCDPH) received a report of three cases…
A: The p- value is a statistical measurement used to validate a hypothesis against the observed data.…
Q: To investigate the properties of cell membranes, a scientist used the Fluorescence Recovery After…
A: Specific light wavelengths stimulate fluorescent markers, which then emit light with a different…
Q: Name two traits that primates have that are modified from an ancestral mammalian form (consider:…
A: Primates usually come under mammalian order and is divided into two sub orders prosimians and…
Q: explain the usage of hypnotic drugs (sleeping pills). What kinds of medicines are utilized, as well…
A: 1. Sleeping pills or hypnotic drugs should only be taken when prescribed by doctor. They are used to…
Q: Which statement below best describes what these data might have demonstrated to Kornberg about the…
A:
Q: Macmillan Learning Hominin is a group of species that includes modern humans and extinct human-like…
A: INTRODUCTION Primates : primates are mammal group including monkeys, apes and human.
Q: There are several lines of evidence that suggest that chloroplasts and mitochondria were once…
A: For performing independent life, energy production is very much important. Some organisms depend on…
Q: About how many carbon (14) beta decays occur in your body every minute?
A: Carbon 14 has a half life about 5730 years where it is reached at its 50%. 8 thousands atoms decay…
Q: Choose the statement that best describes the outcome of transfecting cells with a plasmid that…
A: A plasmid is an extra chromosomal DNA present within a cell. It is physically separated from the…
Q: A) Identify the structures that would be found in proteins B) identify the structures that…
A: Introduction Large biomolecules and macromolecules known as proteins are made up of one or more…
Q: 8.The arm is known as the ________ region; the neck is known as the ________ region.? a. otic;…
A: Introduction :- The network of nerves known as the brachial plexus transmits information from the…
Q: population of 100-200 individuals. The island population is descended from a few individuals that by…
A:
Q: CROSS 1 2 3 4 ROOSTER walnut Walnut Walnut walnut CROSS 1 HEN Walnut Single 2 3 4 pea walnut What…
A: Given: In poultry, the shape of the comb may be rose (A_bb), pea (aaB_), walnut (A_B_), or single…
Q: The arm is known as the ________ region; the neck is known as the ________ region. a. otic; axillary…
A: We can say that The human body is complex machinery that is anatomically divided into three…
Q: Describe the importance of dietary sugars and lipids. In your answer, discuss in detail the impact…
A: Introduction A macromolecule, such as a protein or nucleic acid, is a very big molecule crucial to…
Q: The plasmids from the pUC series are created in the University of California. They carry a lacZ gene…
A: The pUC series plasmids have a lacZ gene that act as a selectable marker. The lacZ gene contains the…
Q: missing a name or two from the list (Enterobacter aerogenes), and (Serratia rubidaea)- should be 20…
A: Biochemical testing and staining procedures are used to identify bacteria. For example, in substrate…
Q: - Solve the following genetic problems with a Punnett square 1. An organism that shows a dominant…
A: Introduction : Genotypenis defined as the genetic information passed down from one generation to…
Q: How can we determine whether predation is controlling the size of a population? What are the…
A: There is basically inter specific competition type of interaction that exist between prey and…
Q: Use the survivorship curves (A, B, and C) shown on the graph below to answer the following three…
A:
Q: What is the pathophysiologic basis for Ms. Rainwater's increased respiratory rate, blood pressure,…
A: Pathophysiology represent the abnormal physiological changes which represent a particular disease.…
Q: What is color opponency and how is it coded in the retina?
A: The human visual system decodes colour information by processing photoreceptor cell impulses in an…
Q: of three cases of hemolytic uremic syndrome (HUS) among children caused by Escherichia coli O157:H7…
A: Hemolytic uremic syndrome is life threatening sometimes. The symptoms are diarrhoea (bloody), fever,…
Q: During the colony selection at the end of the cloning step, there is a possibility of encountering…
A: During colony screening, false colonies in the plates hinder the selection process, which is…
Q: Which of the following components found in the bone matrix make bone somewhat flexible and…
A:
Q: M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not…
A: A vector is a living organism that transmits an infectious agent from an infected animal to another…
Q: Draw a pyramid of numbers using the following data: 480 phytoplankton, 900 zooplankton, 200 C.…
A: PYRAMID OF NUMBER- The number of distinct creatures present at each level of an ecosystem's food…
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: The genomes of two E. coli strains are compared in Figure 14-19. Would you expect any third strain…
A: The availability of this genome sequence will aid in the identification of genes responsible for…
Q: There are different type of fixatives, classify those fixatives based on its COMPOSITION and ACTION…
A: Fixatives are the physical agents or chemical substances which are used to stabilize or preserve the…
Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…
A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…
Q: ANCOVA
A: The protective effect of E.farcium on s.typhimurium infection induced damage. This study compares…
Q: 13. The process of "cell drinking" is called: a. phagocytosis b. exocytosis c. pinocytosis d.…
A: 13 . c. pinocytosis reason : Pinocytosis: In this procedure, the organisms consume the liquid. It's…
Q: Describing characteristic what gave homo habilis it's name
A: The extinct species of human known as Homo habilis, sometimes known as "able man" or "handyman," was…
Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…
A: Given data:- Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…
Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…
A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
- Write the cross using correct symbols. What kind of cross is this called?
Step by step
Solved in 3 steps with 1 images
- In cats, the genotype AA produces tabby fur color; Aa is also a tabby, and aa is black. Another gene at a different locus is epistatic to the gene for fur color. When present in its dominant W form (WW or Ww), this gene blocks the formation of fur color and all the offspring are white; ww individuals develop normal fur color. What fur colors, and in what proportions, would you expect from the cross AaWw Aa Ww?1. You are given a female F1 of unknown genotype. You cross the female fly to a homozygous male that has forked bristles and malformed eyes. The offspring of the cross is shown below: (Define symbols for your traits) Phenotype Forked bristles, normal eyes 752 Number Genotype Forked bristles, malformed 56 eyes Malformed eyes, normal bristles Normal eyes, normal bristles 820 64 a. What are the genotypes of the offspring? b. Based on the progeny, what were the genotypes of the F1 parents? What is the distance between for and mal?1. The allele G for yellow stigma is completely dominant to green (g). Supposingtwo strains of autotetraploid plants are available and their genotypes are as follows:GGgg – in this plant the gene is close to the centromereGggg – in this plant the gene is far from the centromere If these two plants are crossed:a) provide the gametes that can be obtained from the two plants;b) provide the genotypic and phenotypic ratios of the offspring. 2. Consider the illustration below. Diagram the configuration you would observe at Anaphase I if crossing-over happens within the inversion. (IMAGE ATTACHED)
- 3. The allele b gives Drosophila flies a black body and b+ gives brown, the wild-type phenotype. The allele wx of a separate gene gives waxy wings and wx+ gives nonwaxy, the wild-type phenotype. The allele cn of a third gene gives cinnabar eyes and cn+ gives red, the wild-type phenotype. A female heterozygous for these three genes is testcrossed, and 1000 progeny are classified as follows: 5 wild type; 6 black, waxy, cinnabar; 69 waxy, cinnabar; 67 black; 382 cinnabar; 379 black, waxy; 48 waxy; and 44 black, cinnabar. Are these three genes linked? If so, draw a map of the chromosomes in the heterozygous parent, showing the order, arrangement, and map distance between the linked genes.1.In Drosophila melanogaster body color is controlled by one gene while wing shape is controlled by a second gene. Gray body color is dominant to black body color, and normal wings are dominant to vestigial wings. Flies homozygous for gray body color and vestigial wings are crossed with flies homozygous for black body color and normal wings. A.compare the possible f2 generation genotypes and phenotypes and proportions if these two traits. B.How does your answer change if one of the original parents is homozygous for gray body color and normal wings while the other has black body color and vestigial wings?2.) In fruit flies, L= long wings and 1= short wings. When a long-winged fly is crossed with a short-winged fly, the offspring exhibit a 50:50 phenotypic ratio. What is the genotype of the parent flies? Prove how this is possible. Develop a Punnett square, and then list the genotypes and phenotypes.
- 15. B. You set up a cross between a male fruit fly with lobe eyes and a true breeding female fruit fly with reduced bristles and disrupted wings. In the F1 offspring you see the all the flies have WT bristles and WT wings. However, half the flies have WT eyes and half the flies have lobe eyes. You take 20 of the F1 female flies with lobe eyes and mate them to 20 true breeding male flies with reduced bristles and disrupted wings and observe the following offspring: 164 lobe eyes and reduced bristles 137 lobe eyes and disrupted wings 638 reduced bristles and disrupted wings 152 reduced bristles 40 wildtype 175 disrupted wings 659 lobe eyes 35 lobe eyes reduced bristles and disrupted wings Calculate the interference for this region.2. In Drosophila sp. Red eyes are dominant over white eyes. Normal wings are dominant over vestigial wings. Homozygous red eyes normal wings females were crossed with homozygous white eyes and vestigial wings males. The F2 generation after a test cross are as below Phenotype Red eyes, normal wings White eyes, vestigial wings Red eyes, vestigial wings White eyes, normal wings Amount 1670 1590 425 435 a) Are the wings and eyes colour genes linked? b) Show all the crosses c) Calculate the recombination frequency value. d) What is the distance between the wings and eyes colour genes?14. A wildtype fruit fly (heterozygous for gray body and normal wings) is mated 2 poin with a black fly with vestigial wings. Offspring: 778-wild type 785-black vestigial 158-black-normal wings 162 gray body-vestigial wings. 1. What is the recombination frequency between these genes? 2. Are the genes linked? Explain why or why not. *
- 3. What is the genotypic ratio of the testcross shown in Figure 4? 4. Give the phenotypic and genotypic ratio of the following testcrosses of dihybrids: Cross A Cross B P ΥY RR yy rr P YY Rr yy rr F1 F, YR Yy Rr YR Үy Rr (Y Yy rr Cross C Cross D P. Yy RR yy rr P Yy Rr yy rr F, F, (yr Y R Yy Rr Y R Yy Rr y R yy Rr Yy rr (y R yy Rr yy rr0. In Drosophila, the gene for cinnabar eye color is onchromosome 2, and the gene for scarlet eye color is onchromosome 3. A fly homozygous for both recessivecinnabar and scarlet alleles (cn/cn; st/st) is white-eyed.a. If male flies (containing chromosomes with thenormal gene order) heterozygous for cn and st allelesare crossed to white-eyed females homozygous forthe cn and st alleles, what are the expected phenotypes and their frequencies in the progeny?b. One unusual male heterozygous for cn and st alleles,when crossed to a white-eyed female, produced onlywild-type and white-eyed progeny. Explain the likelychromosomal constitution of this male.c. When the wild-type F1 females from the cross withthe unusual male were backcrossed to normal cn/cn;st/st males, the following results were obtained:wild type 45%cinnabar 5%scarlet 5%white 45%Diagram a genetic event at metaphase I that couldproduce the rare cinnabar or scarlet flies among theprogeny of the wild-type F1 females.IV. Other dihybrid cross Gene symbols v vestigial wing size V normal wing size s sepia eye color S red eye color The parents were vestigial, red eyed color female and normal wing size, sepia eyed color male Diagram of P1 cross: You are crossing F1s. Diagram of F1 cross: Give expected F2 phenotypic ratio: Give expected F2 genotypic ratio: