Write the name of disease occur due to Nonhomologous End Joining Repair.
Q: Explain the connection between defects in DNA repair systemsand the inherited human disease…
A: Genetic disorder It is also called as inherited disorder and is caused due to, Chromosomal…
Q: A piece of DNA ejected by a bacterial cell through a tube-like passage through the cell wall is…
A: Bacterial cells divide by binary fission in which one parent cell divides into two identical…
Q: hich repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair…
A: When many proteins and RNAs are damaged, they will be degraded and sugars, are metabolized in order…
Q: What do you mean by Error-Prone Repair by Nonhomologous End Joining?
A: Non-homologous end joining (NHEJ) is a pathway that repairs double strand breaks in DNA. NHEJ is…
Q: Label the DNA structure below.
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Name the disease occur due to defective Nonhomologous End Joining Repair.
A: There are four phases of cell cycle G1, S, G2 and M. Most of the DNA repair occur in G1 phase of…
Q: Given the following enzymes, fill up the table. You may repeat answers in each column. Replication…
A: Central dogma Central dogma involves the process that encodes the functions of a gene leading to…
Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…
A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…
Q: D 5. Choose the letter that corresponds to the step in the process where a restriction enzyme is…
A: The letter that corresponds to the step in the process where a restriction enzyme is used - Step A.…
Q: Provide a detailed description and hand drawn figure of each of the following. (1) Mismatch…
A: Although the genetic variation is important for evolution, the survival of the individual demands…
Q: Single nucleotide polymorphisms are found ina. DNA. b. RNA.c. plasmidsd. siRNA
A: Introduction:- Single nucleotide polymorphisms are defined as loci with alleles that differ at a…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…
A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…
Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…
A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…
Q: G>
A: DNA stands for deoxyribonucleic acid. It is the genetic material in the cell.
Q: Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the…
A: Answer :-
Q: Cxikeria DNA Transcription Translation Location
A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…
Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…
A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Telomeres…
A: DNA is the genetic material that exists in every cell in your body . This DNA is wrapped up with the…
Q: Detail the differences between base excision repair and nucleotide excision repair. Please help…
A: The damaged DNA is repaired as required because mutated DNA is not allowed to enter the cell…
Q: Semi-conservative replication:
A: DNA refers to deoxyribonucleic acid. It is the genetic material in almost all organisms, except some…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the…
A: A virus may be a variety of virus that infects bacteria. In fact, the word "bacteriophage" virtually…
Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…
A:
Q: The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes…
A: Mutation: It is a heritable change in the genetic material of an organisms that give rise to…
Q: Compare and contrast F+ x F- and F' x F- conjugation.
A: In Bacteria there are different methods of gene transfer,it occurs between two different chromosomes…
Q: A point mutation could be caused bya. depurination.b. deamination.c. tautomeric shift.d. any of the…
A: A mutation that could only affect a single nucleotide of the nucleic acid is known as a Point…
Q: Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…
Q: Define the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e.…
A: a. DNA typing: DNA typing can be defined as the procedure in which variations in the DNA strand is…
Q: Define the following terms: a. transfection b. replicative transposition c. composite transposition…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: explain topic is about how recombinant DNA is made
A: In this method DNA from two different species is isolated and inserted into a host organism to…
Q: The type of DNA replication error illustrated in the diagram below is _______________________
A: Frameshift mutation .
Q: Define the following terms:a. RFCb. DNA glycosylasec. apurinic sited. apyrimidinic sitee. mismatch…
A: Introduction:
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: ive the SIGNIFICANT difference between the terms provided in the table below.
A: Somatic Mutation Germline Mutation It occurs in the non-germline cells i.e. except…
Q: Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding…
A: Introduction:
Q: From the sequence given below, provide the ff: 2. ATGT 1. DNA Complement: 2. RNA strand: -- --- L---…
A: DNA contains the genes which is the marker for an organism. Gene expression varies from individual…
Q: Write a short note on replication of DNA.
A: DNA replication is semi-conservative and bidirectional. It occurs in S-phase of cell cycle. details…
Q: Choose all minor nucleosides Anenosin-cyclomonophosphate Thymidin Pseudouridin Pyromycin
A: Nucleosides are the compounds made up of nitrogen base and sugar residues. Minor Nucleosides are…
Q: draw structure of plasmid
A: The plasmid is the extrachromosomal deoxyribonucleic acid (DNA) that is present with the bacterial…
Q: RNase H will remove ribonucleotide directly linked to the DNA end. True false
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: Please answer part 1A and 1B please I will upvote then with a proper explanation for the correct…
A: Micro satellites are short short DNA segments usually 1 to 6 base pairs that is repeated multiple…
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…
Q: Define the following terms: a. transposition b. DNA glycosylase c. apurinic site d. apyrimidinic…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O…
A: The DNA (deoxyribonucleic acid) is genetic material of an organism that it inherits from the parent…
Q: Define the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. replicon
A: DNA represents the genome of a variety of organisms and can exist in single-stranded or double…
Write the name of disease occur due to Nonhomologous End Joining Repair.
Step by step
Solved in 2 steps
- Fill in the following table:Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.Which letter represents the target site of furosemide (Lasix)? E- -B
- Which kind of chemical damage is depicted in this picture: 2-OH Ostrand breakage Obase deletion Obase modification O base cross linking is inAmong the following structures, the drug that can be given orally against B-lactamase-producing strain: is: CO-H OCH COOH I COOH II NH2 HO COOH III IV COOH Oll ONone of the above OlI OIVb) Draw the single-stranded segment correctly.
- Identify the chromosomal mutations that occurred in the cell based on the original/normal chromosome composition provided in the procedures. Be very specific with the type of mutation. Chromosomal Mutation/s: Arrangement of Chromosomes during Metaphase I:List three ways in which an unrepaired double-stranded DNA break can be highly dangerous to the cell in which it occurs.Why is 26 incorrect