You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter regions, where the RNA polymerase II and transcription factors would bind THERE ARE MULTIPLE ANSWERS THAT YOU CAN CHOOSE From the list given - choose all components that you think are part of a typical eukaryotic gene Group of answer choices A core promoter B 3'UTR C introns D enhancer E coding sequence F mediator protein G PPE H exons I DNA-bending protein J 5'UTR

You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter regions, where the RNA polymerase II and transcription factors would bind THERE ARE MULTIPLE ANSWERS THAT YOU CAN CHOOSE From the list given - choose all components that you think are part of a typical eukaryotic gene Group of answer choices A core promoter B 3'UTR C introns D enhancer E coding sequence F mediator protein G PPE H exons I DNA-bending protein J 5'UTR

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA
From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator protein
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factors
Where does transcription take place? nucleus cytoplasm ribosome mitochondria Why must transcription occur where DNA can be found? because DNA can't leave because ribosomes are in the nucleus because DNA polymerase is found there because helicase unzips the DNA How many nucleotides equal 1 amino acid? 1 3 TRANSCRIBE this DNA sequence: TACGTTACT AUGCAAUGA ATGCAATGA AUGGATUGA TACGTTACT É O O O O O O O O
Think of the eukaryotic gene expression process. Which column below accurately describes which components of the gene are translated by ribosomal complex? Component A В D Ribosomal binding site Yes No No Yes Promoter Yes Yes No No Exons Yes Yes Yes Yes Introns No Yes No No C O A
Transcription Translation stop site start site Intron 1 Promoter Exon 1 Exon 2 Intron 2 Exon 3 | Transcription stop site What kind of mutation would you introduce to render the gene above such that it is expressed with a normal functioning protein, but less protein produced overall compared to the non-mutated gene? Explain in 1-2 sentences, including where the mutation would be located.
Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop sile Transcription start site 5- 31 ATG 75 TAC TAA ATT 3' 5' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice аcсeptor Splice acceptor Splice donor Stop codon Exons Ribosomal binding site Promoter Introns
Modifications of histone tails can: O repress the transcription of some genes affect chromatin structure affect the transcription of some genes in response to the diet or environment activate the transcription of some genes all of these choices are correct The ferritin gene encodes an IRE (Iron-response element) within the 5 UTR (untranslated region) of the MRNA Considering what you know about eukaryotic translation, the IRE-BP (Iron Response Element Binding Protein) is bound to the IRE in the 5'UTR. you would expect: O That the presence of the IRE-BP would enhance translation. That the presence of the IRE-BP would have no effect. That the presence of the IRE-BP would block translation I don't remember enough about the IRE-BP or transiation to guess. 3 Assuming that the trait represented by the filled symbols in the pedigree is an inherited trait due to a single gene with alleles A and a, what mode of inheritance does the pedigree shown suggest?
a QUESTION 7 Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below (not all of the words will be used): Rat1 ATP Adenosine AAUAAA Rho TATA A-site RNA polymerase Uracil Rut site Guanosine Hairpin There are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a protein complex called This protein complex binds to the which is located on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerase complex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNA termination sequence that contains a secondary structure called a followed by a string of nucleotides. Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence, is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of the termination sequence. Once cleavage occurs, binds to…