1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with Sbf1, Pst1, and a mixture of Sbf1 and Pst1.
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: Penicillin heralded the dawn of the antibiotic age when it was discovered in 1928 and is now the…
A: Penicillin is now widely used antibiotic and hence its accurate concentration determination is…
Q: rotein kinase inhibitors have become a major focus for the development of molecularly targeted…
A: Introduction: A substance that blocks the action of an enzyme is called protein kinases. There are…
Q: How histone and micro RNA controls gene expressi
A: Histones are positively charged basic proteins that associate with DNA in the nucleus and forms…
Q: Which types of ion exchange resin will the the peptide Ala-Glu-lle-Lys- Leu-Asp-Gly bind to at the…
A: Ion exchange chromatography consists of column with loaded resin that can exchange oppositely…
Q: ection steps! Which of the following are proper disir ORemove organic matter O Disinfect only O…
A: Microscopic organisms such as bacteria, fungi (mold and yeast), protists, archaea, algae,…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases. True False
A: Eukaryotic transcription:- In Eukaryotes, 3 different kind of RNA polymerase are used.
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: There will be three graphs. They as given below:
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: 8. Why are histamine and serotonin contents increased in the site ol inila latory?
A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue…
Q: Calculate the values of the
A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…
Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…
A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: Question 3 N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the…
A: A antigen is the antigen that is important for blood grouping of individuals. Antigen A and Antibody…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…
Q: Many malignant tumors are characterized by the activation of one or more growth-factor receptors.…
A: Malignant tumours (or "cancers") are classified as monoclonal, which means that each tumour develops…
Q: A man just ate a plant-based hamburger with a bun and nothing else on the sandwich.Coincidentally,…
A: As man ate plant-based hamburger with a bun. Plant based hamburger is made up basically from…
Q: 18:3CA9,12,15
A: Alpha Linolenic acid is essential fatty acid, highly concentrated in plant oils. Essential fatty…
Q: Chemistry A homotetramer (lacking intermolecular covalent interactions) has a native molecular size…
A: Protein structures are organized into four structural levels of organization: primary, secondary,…
Q: QUESTION 5 Using SP-Sepharose as ion exhange resin, indicate the starting and ending pH for the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Biological relationship between hydrogen peroxide and catalase?
A: Reactive oxygen species (ROS) are generated due to the partial reduction of oxygen in the electron…
Q: Match the each enzyme deficiency with their corresponding disease…
A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…
Q: Calculate the fractional charge on ASP at pH 3 using the following pKa values (1. 9.90, 3.90). Write…
A: A total of 300 amino acids are present in the biological system out of the 20 are part of…
Q: Explain to me what factors influence permeability versus solubility?
A: To understand the factors effecting the solubility and permeability it is essential to understand…
Q: Question 5 In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B A.
A: Cell membrane is made up of lipid bilayer. The composition of different types of lipids has very…
Q: Which of the following refers to the test performed 2 hours after an overnight-fasted patient was…
A: Different tests are used to test the blood glucose level.
Q: Starting from the O2 binding equilibrium of human hemoglobin written below, derive the Hb + nO2 2…
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a non-covalent…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: a. Name the phosphoinositide generated through the action of PI-5 kinase. b. Name the products…
A: Phosphatidylinositol (PI)-related signalling is important for survival, cell proliferation,…
Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…
A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…
Q: Compare the net production of ATP from four molecules of glucose (4 x C6) with that from one…
A: Glucose is oxidized through glycolysis, pyruvate dehydrogenase reaction, and the TCA cycle into…
Q: 1. What are processed foods?
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: State what is the likely magnitude of the Hill constant (nH) for HbA from your reading and state…
A: Hill equation is reflects the occupancy of biomolecule by respective ligands. i.e. fraction of…
Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…
A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…
Q: Review method used to increase the solubility of a drug under the following headings co solvents PH…
A: Bioavailability is a powerful determinant of drug absorption. It represents the administered dose…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: All of the following are standard tests used in diagnosing diabetes EXCEPT O Glycated hemoglobin…
A: Diabetics is disease in which blood glucose level in increase more than 126mg/dL.In diabetics…
Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…
A: Digitoxin is a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: There is an error in the lactic acid fermentation reaction given in question. The correct…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: What is an enzyme in biology?
A: Different types of cells, tissues, and other complex organs make up the human body. To maintain a…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…
A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…
Q: Describe the mutational event that produces the MYC oncogene in Burkitt’s lymphoma. Why does the…
A: Burkitt lymphoma is a type of non-Hodgkin lymphoma that affects adults and children. NHL is a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bpBelow is a plasmid with restriction sites for Baml and EcoRI, Several restriction digests were done using these two enzymes either alone or in combination. Hint: Begin by determining the number and size of the fragments produced with each enzyme. "kb" stands for kilobases, or thousands of base pairs. Plasmid Gel lanes I | III IV V 6 Kb Bam HI Bam HI. 20 Kb PGEN101 (20 Kb) 2 Kb 11 Kb Bam HI 8 Kb 8 Kb 4 Kb 6 Kb Eco RI 3 Kb 21. Which lane shows a digest with BamHl only? a. I b.I c. II d. IV e. V 22. Which lane shows a digest with EcoRLonly? a. I 23. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? a. I b.I c. II d. IV e. V b. I c. II d. IV e. V Base pairs
- You will be setting up your diagnostic digest on three plasmids, the ones you began with, pGFPuv and PHSG298 and your presumptive pHSG298-GFP. Complete the table below: Solution Stock Working Volume for one reaction Volume for Master Mix (3.5X) Cutsmart buffer 10X 1X Restriction enzyme(s) 1 µl uL Water UL UL 2 µl 25 pL DNA Total volumeYou digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?E 1 kb 1 kb DAK 6 kb Gene X E1 kb B 5 kb. Gene Z E₁kb 1 kb The figure above shows a linear chronosome containing Gene X and Gene Z and the location of sites for the restriction enzymes EcoRI (E) and BamHI (B). Refer to this map as you answer the question below. If you digest this DNA with EcoRI, then perform agarose gel electrophoresis, how many bands, and what sizes, would you expect to see? a) Two bands on the gel corresponding to the sizes 2 kb and 6 kb b) Three bands on the gel corresponding to the sizes 1 kb, 6 kb and 8 kb. c) Three bands on the gel corresponding to the sizes 1 kb, 5 kb and 6 kb d) Four bands on the gel corresponding to the sizes 1 kb, 2 kb, 5 kb and 6 kb e) Four bands on the gel corresponding to the sizes 2 kb, 3 kb, 4 kb and 8 kb
- Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (Part a is attached)A piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece of DNA is digested with two restriction enzymes, EcoRI and BamHI, individually and in combination, and the resulting fragment sizes are determined by electrophoresis. The results are as follows: Restriction fragment size 4.5 kb; 0.5 kb 3.0 kb; 2.0 kb 2.5 kb; 2.0 kb; 0.5 kb Enzyme name EcoRI ВатHI EcoRI + BamHI Construct a potential restriction map based on these results.
- A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to produce a 3000 bp and a 2000 bp bands when visualized on an agarose gel. When digested with one enzyme at a time, only one band is visible at 5000 bp. If the first site for enzyme A (A1) is present at the 100h base, the order in which the remaining sites (A2, B1 and B2) are present is - (A) 3100, 5100, 8100 115. (B) 8100, 3100, 5100 (C) 5100, 3100, 8100 (D) 8100, 5100,. 3100A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindlII 2.6 ЕcoRI + Hpall ECORI + HindlII 1.3, 0.8, 0.5 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?A) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved