Q: - Lov 12pts) w and p 1. Calculating flow and velocity (1pt) Name: Lana has a 2 meter long clear…
A: Step 1: Step 2: Step 3: Step 4:
Q: One of the main characteristics that defines the hominin tribe are their bipedal tendencies.…
A: Approach to solving the question. Key references:Article: Kimbel, W. H., & Villmoare, B. (2016).…
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: Mendelian Genetics - More Practice AAA Ha b Bb bb 1. A tetrahybrid individual, AaBbCcDd, is crossed…
A: The cross in the above question is AaBbCcDd X AABbCcdd Now we will calculate the probability…
Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…
A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…
Q: Diagram the female reproductive system, describing where and how ova are formed.
A: Reproductive system (or genital system) is involved in sexual reproduction. The male and female…
Q: A premature infant typically lacks subcutaneous adipose tis- sue. Also, the surface area of an…
A: A imperative physiological work, thermoregulation, the capacity to regulate body temperature…
Q: RBCs are recycled constantly through the bone marrow. Question 11 options: True…
A: Production and Lifespan of Red Blood Cells (RBCs)Red blood cells (RBCs), also known as erythrocytes,…
Q: 5. The autoclave raises the atmospheric pressure to _____ : a) 10 psi b) 15 psi c) 20 k joules d) 25…
A: Approach to Solving the Questions:To answer the questions, it's essential to understand the concepts…
Q: QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated…
A: Solution:
Q: Which are the most important factors determining the magnitude of the pulse pressure?
A: Pulse pressure, a necessary cardiovascular well-being marker, is characterized as the difference…
Q: Please answer everything with explanation. In The Day of the Triffids, after most people in the…
A: In order to reply to the inquiries, need to go over each one in detail utilizing the basic thoughts…
Q: What is photosynthesis?
A: Photosynthesis is a biological process that occurs in green plants, algae, and some bacteria. It is…
Q: Why the answer is 0.60. please explain
A: 1. **Graph Interpretation**: - The graph serves as a visual representation of the changes in the…
Q: STEM Workplace Practices
A: Explanation is given in answer itself.
Q: What is an adaptation in the context of evolution? A heritable trait that was favored by natural…
A: The objective of the question is to understand the concept of adaptation in the context of…
Q: Answer the following questions on Genetic Counseling: 1. What “soft” skills does a genetic counselor…
A: In conclusion, genetic counseling encompasses a diverse set of skills and ethical considerations…
Q: ) How to solve for creatinine coefficient with 59kg and 1, 500ml estimated total volume for 24hrs of…
A: When investigating the function and health of the kidneys, the estimation of creatinine in urine…
Q: Please help urgently thank you
A: Q4.1.1Mean= (5⋅5)+(15⋅18)+(25⋅33)+(35⋅11)+(45⋅3)\70 = 825+270+825+385+1\70=34.86Interpretation: The…
Q: Distinguish between dehydration synthesis and hydrolysis.
A: In science, numerous crucial processes include synthesizing and breaking down complex particles. Two…
Q: Relative Hormone Concentration 8 12 ♡ Days of Estrous Cycle The graph above shows the hormonal…
A: Approach to solving questions about a graph:Identify the key elements:Labels: Look for titles, axis…
Q: What physical appearance (Solid, liquid, semi-solid) of following Media: Broth tube, agar slant…
A: Agar is a polysaccharide composed of agarose and agaropectin. It is a gelatinous substance used in…
Q: Discuss why hypertension is considered the silent killer and why don't people take their high blood…
A: Why Hypertension is a Particularly Deceptive Threat: Hypertension, or high blood pressure, has…
Q: Define about Whole-Exome Sequencing ?
A: Whole- exome sequencing( WES) is a genomic approach for sequencing all of the protein- encoding…
Q: What is the advantage of homology-directed repair (HDR) ?
A: One of the most vital cellular processes called homology-directed repair (HDR) is capable for fixing…
Q: 2. What was the average velocity (mean speed) of the above object, when considering the entire time…
A: average speed doesn't account for the direction of the motion. Here's why:The object is falling,…
Q: Part 1: Use this image to describe the relationship between H, F. and D, including how closely they…
A: Detailed explanation:let's dissect each part of the question based on the hypothesized phylogenetic…
Q: Fill in the blank with the appropriate volume range for the micropipette size. Size P20 Volume μι -…
A: The limits are: P10: 1.0 - 10.0 !l P20: 2.0 - 20.0 !l P200: 20 - 200 !l P1000: 200 - 1000 !l
Q: Why are chromosomal abberations considered to have less significance than gene mutations for…
A: The question is asking about the relative significance of chromosomal aberrations and gene mutations…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: Describe the difference between relative and absolute dating, making sure to give an example of a…
A: The objective of this question is to understand the difference between relative and absolute dating,…
Q: A scientist was investigating if differences in the frictional work performed on a model car can…
A: The relationship between force and distance to determine the work done by friction is:Wf =…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: please answer all if possible i need it badly and asap make sure its correct
A: Detailed explanation: 9): The correct answer is option (d): II, III, IV, and V are responsible for…
Q: Some sperm mitochondria enter an egg during fertilization, but as sperm mature these mitochondria…
A: Fertilization in people alludes to the combination of male and female gametes that facilitates the…
Q: How do finches reconize members of their own species?
A: The objective of the question is to understand how finches, a type of bird, recognize members of…
Q: Blood is a constantly circulating fluid providing the body with nutrition, oxygen, and waste…
A: Detailed explanation: Red Blood Cells (Erythrocytes):Red blood cells are specialized cells that lack…
Q: Which of the following are regulators of Cdks? Choose all that apply. There are 3 correct answers.…
A: Cyclins: Cyclins are positive regulators of Cdks, which form complexes that regulate the cell cycle.…
Q: The French philosopher and mathematician Rene Descartes is credited with proposing arguments in…
A: The objective of the question is to identify which of the given ideas was not proposed by Rene…
Q: DNA: Using the two deoxynucleotides you chose, draw the two monomers bound together into a compound,…
A:
Q: Translational control is usually aimed at preventing the initiation of translation. With regard to…
A: The process of translating the sequence of mRNA into an amino acid sequence is called translation.…
Q: What is the sequential pattern of mutations commonly observed in the development of colorectal…
A: 1. Colorectal Adenocarcinoma Overview:CRC arises from the epithelial lining of the colon or…
Q: A graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella…
A: Given:At 20°C: Strain A LD50 = 100, Strain B LD50 = 1000. At 37°C: Strain A LD50 = 1000, Strain B…
Q: List and describe the three outcomes of complement activation.
A: Detailed explanation:Complement activation is an essential part of the immune response, involving a…
Q: Imagine you have been given a liquid culture of yeast with a starting concentration of 3.67 x 10'…
A: To obtain the cells after dilution:cells in the original container*dilution factor To obtain the…
Q: DNA Fingerprints Bird flu, Swine flu and Monkey flu are highly contagious strains of flu. A Bird Flu…
A: Detailed explanationGiven the following scenario, we are provided with DNA samples from individuals…
Q: Explain how decomposition contributes to nutrient cycling in the soils
A: Nutrient cycling refers to the exchange and transfer of biogenetic nutrients such as those essential…
Q: Read over the following article from the New York Times It describes a study in which researchers…
A: The research that looks at the hundreds of distinct chemicals that change in the bloodstream before,…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A:
Q: Stark law (Physician Self-Referral Law) Summarize the law or regulation above. Describe the entity…
A: Here's a detailed breakdown of how I approached solving the questions regarding Stark Law, including…
What, if any, are potential restriction enzyme recognition sequences in this DNA? (Only consider sequences of 6 bp or longer.) Using any of the sites which you identified in above, illustrate cleavage positions for that site which will result in a 5’ overhang or a 3’ overhang respectively.
Step by step
Solved in 2 steps with 1 images
- Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
- You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
- 6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
- Е. F. С. D. A. B. COMPLEMENTARY BASE PAIRING 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus X174: ATG T GT CA AAGACGGT Dayonna Rucker C C T G T T T T G T A CCGTCAGGATTGA G T T T T C A T G C CТССАААТСТТThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'