Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 7P
The human protein lactate dehydrogenase shown in Fig. 1.4 has 332 amino acids. What is the smallest possible combined size of the parts of the gene that specify this protein using the genetic code?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
When the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.
Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the nucleotide sequence of the gene that codes for one of these enzymes is: AUG CCU UGG GCC CAA AAA UGC A series of mutants that have lost activity for this enzyme are recovered. The mutant products are analyzed and found to have the following amino acid sequences: Mutant 1: Met-Pro-Trp-Pro-Glu-Lys-Cys Mutant 2: Met-Pro Mutant 3: Met-Pro-Cys-Gly-Pro-Lys-Met Mutant 4: Met-Pro-Trp-Pro-Lys-Asp Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Nonsense Answer Missense Answer Addition Answer Deletion Answer
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Chapter 1 Solutions
Genetics: From Genes to Genomes
Ch. 1 - Choose the phrase from the right column that best...Ch. 1 - If one strand of a DNA molecule has the base...Ch. 1 - The size of one copy of the human genome is...Ch. 1 - Indicate whether each of the following words or...Ch. 1 - a. How many different DNA strands composed of 100...Ch. 1 - RNA shares with proteins the ability to fold into...Ch. 1 - The human protein lactate dehydrogenase shown in...Ch. 1 - a. Are the triplets in the genetic code table...Ch. 1 - Why do scientists think that all forms of life on...Ch. 1 - Why would a geneticist study a yeast cell or a...
Ch. 1 - How can a scientist tell if a protein present in...Ch. 1 - Figure 1.6 shows the amino acid sequences of parts...Ch. 1 - Why do scientists think that new genes arise by...Ch. 1 - Explain how the exon/intron structure of genes...Ch. 1 - Mutations in genes that change their pattern of...Ch. 1 - A single zebrafish gene function was inactivated...Ch. 1 - Different mutations in the WDR62 gene that...Ch. 1 - Researchers have successfully used gene therapy to...Ch. 1 - By the time this book is published, it will likely...
Additional Science Textbook Solutions
Find more solutions based on key concepts
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
Explain why hyperthermophiles do not cause disease in humans.
Microbiology with Diseases by Taxonomy (5th Edition)
6. How can you use the features found in each chapter?
Human Anatomy & Physiology
Figure 1.18 In the example below, the scientific method is used to solve an everyday problem. Which part in the...
Concepts of Biology
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.arrow_forwardA glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid substitution at position 210? What are they? How many will result if the wild-type codon is GGU?arrow_forwardIn studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.arrow_forward
- The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forwardA recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.arrow_forwardThe following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forward
- The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the sequence of the RNA transcript specified by this part of the gene? (5') (3¹')arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwardYou are interested in studying a unique protein found in a rare wildflower found in the desert region of Atacama. The wild-type amino acid sequence isolated from this flower is: Wildtype: Arg-Lys-Thr-Leu-Gly-Arg A mutant for the gene that specifies this protein is isolated and the amino acid sequence of its protein is determined: Mutant: Arg-Lys-Thr-Leu-Gly-Gly a) Identity what the mutation changed in the amino acid sequence b) What is the effect of the mutation at the amino acid level? c) What is the effect of the mutation at the RNA level? d) What kind of mutation happened at the DNA level?arrow_forward
- a protein with a molar mass of 3800 g/mol is given. determine the number of nucleotides contained in the gene that encoded this protein, knowing that: 20% of it are introns, the mass of a nucleotide is 300 g/mol and the mass of an amino acid is 110 g/molarrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardAn enzyme isolated from rat liver has 193 amino acids and is and encoded by a 1440 base pair long gene. What is the connection between the amino acid number of the enzyme and the number of nucleotide pairs in its gene. Explain clearly pleasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY