Genetics: Analysis and Principles
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 19, Problem 1CONQ

Is each of the following mutations a transition, transversion, addition, or deletion? The original DNA strand is

5′–GGACTAGATAC–3′

(Note: Only the coding DNA strand is shown.)

A. 5′–GAACTAGATAC–3′

B. 5′–GGACTAGAGAC–3′

C. 5′–GGACTAGTAC–3′

D. 5′–GGAGTAGATAC–3′

Expert Solution & Answer
Check Mark
Summary Introduction

To review:

The kind of mutations that are present in DNA (deoxyribonucleic acid) sequences, while comparing the given sequence 5'-GGACTAGATAC-3' with the following:

A. 5'-GAACTAGATAC-3'

B. 5'-GGACTAGAGAC-3'

C. 5'-GGACTAGTAC-3'

D. 5'-GGAGTAGATAC-3'

Introduction:

Point mutations are a common type of mutation in which, a lone nucleotide in a DNA sequence undergoes change. There could be addition of a nucleotide, deletion of a nucleotide or conversion of one nucleotide into another (transition and transversion mutations).

Explanation of Solution

Mutation is defined as the occurrence of change in the genetic material of an organism, which generally is of permanent nature. Further, more the different types of mutations, which might have occurred in the mentioned parts have been described below:

A. When the given sequence is compared with the new sequence, 5'-GAACTAGATAC-3', at the second position, there is a point mutation which converts G (guanine) to A (adenine). This mutation is a transition mutation, since, one purine nucleotide (G) is changing into another purine nucleotide (A).

B. On comparing the given sequence to the new sequence, 5'-GGACTAGAGAC-3', there is a mutation at the ninth position, wherein, T (thymine) is changing into G. This is called a transversion mutation, since, a pyrimidine nucleotide (T) is changing into a purine nucleotide (G).

C. When compared with the new sequence, 5'-GGACTAGTAC-3', the eighth nucleotide in the given sequence is missing from the new sequence indicating that, this is a deletion mutation.

D. On comparing with the new sequence, 5'-GGAGTAGATAC-3', it is clear that at the fourth position in the given sequence, there is a transversion mutation, since, a C (cytosine), which is a pyrimidine nucleotide, is getting converted into a G, which is a purine nucleotide.

Conclusion

Therefore, it can be concluded that mutations in the given sequences when compared to the reference sequence are: transition, transversion, deletion and transversion, respectively.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is                          5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′
Below is a sample of a segment of DNA…(copy from left to right)   3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’   5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’       1.Assume the 6th amino acid is changed from T to G on the DNA template strand.  What type of mutation is this?  What effect would this have on the protein? Look up an example for this type of mutation.    2, Assume the 5th and 6th amino acids are removed from the DNA template strand.  What type of mutation is this? How would this affect the protein?  Look up an example of this type of mutation.    3.Which mutation changes the protein more...a point mutation or a frameshift mutation.  Explain your reasoning.    4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).    5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this?  If this is on chromosome 4, what genetic disorder is this?…
The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all the mutant sequences that can result from spontaneous depurination in this stretch of DNA. b. Give all the mutant sequences that can result from spontaneous deamination in this stretch of DNA.

Chapter 19 Solutions

Genetics: Analysis and Principles

Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY